Short Hairpin RNA-Mediated Gene Knockdown in iHSPCs In Vitro: A Lentivirus-Based shRNA Expression System Delivery into iHSPCs for Knockdown of Specific Gene Expression

Published: April 30, 2023

Abstract

Source: Hsiao, Y. L., et al. Study of Dendritic Cell Development by Short Hairpin RNA-Mediated Gene Knockdown in a Hematopoietic Stem and Progenitor Cell Line In vitro. J. Vis. Exp. (2022).

In this video, we demonstrate a method to perform transduction of shRNA lentiviral vectors to obtain stable knockdown cell lines in immortalized hematopoietic stem and progenitor cells (iHSPCs).

Protocol

1. Preparation of immortalized hematopoietic stem and progenitor cell lines (iHSPCs)

  1. Maintain iHSPC cell line in complete RPMI 1640 medium containing 100 ng/mL FL and 1 μM β-estradiol.
  2. Passage the cells at a ratio of 1:10 every 3 days.
    NOTE: Make complete RPMI 1640 medium by supplementing with 10% fetal bovine serum (FBS), 5 x10-5 M β-mercaptoethanol, and 10 μg/mL gentamicin. Recombinant murine FL is also commercially available.

2. Lentiviral transduction

  1. Plate iHSPCs at a density of 1 x 105 cells/well in 12-well plates in 1 mL of complete medium containing 100 ng/mL FL, 1 μM β-estradiol, and 8 μg/mL polybrene.
    NOTE: The concentration of polybrene depends on the cell types and is usually in the range of 4-8 μg/mL.
  2. Add shRNA-carrying lentivirus in each well at a multiplicity of infection (MOI) of 100.
    NOTE: The lentiviral vector is pLKO.1-Puro with a puromycin selection marker (Figure 1). The target sequences of shRNAs against LacZ, Tcf4, and Id2, respectively, are listed in the Table of Materials. The MOI is defined by the number of virions that are added per cell during infection.
    Equation 1
  3. Spin the plates at 1,100 x g for 90 min at 37 °C.
  4. Incubate the plate containing infected cells for overnight at 37 °C in an incubator.
    NOTE: If the cells are sensitive to polybrene, then refresh the cells with the complete medium without polybrene after the spin infection.
  5. Refresh cells with complete medium containing 100 ng/mL FL and 1 μM β-estradiol 24 h after the infection.
  6. Add 6 μg/mL of puromycin to the medium to select the infected cells after an additional 24 h.
    NOTE: Transduced lentiviral vector usually takes 48 h for expressing genes, including puromycin resistant gene. Ensure that the concentration of puromycin is optimized for each cell line.
  7. Refresh the selection medium containing 100 ng/mL FL, 1 μM β-estradiol, and 6 μg/mL puromycin every 3 days and maintain the cells for at least one week to expand the stably transduced iHSPC cells.
    NOTE: Puromycin selection usually takes effect 48 h later, and the period of selection depends on cell types.

Representative Results

Figure 1
Figure 1: The construct of lentiviral vector pLKO.1-Puro.

Offenlegungen

The authors have nothing to disclose.

Materials

1.5 mL Micro tube  ExtraGene  TUBE-170-C
12-well tissue culture-treated plate  Falcon  353043
Fetal bovine serum (FBS)  Corning  35-010-CV
RPMI 1640 medium  Gibco  11875-085
β-estradiol   Sigma-Aldrich E2758-250MG
β-mercaptoethanol (β-ME)  Sigma-Aldrich  M6250
Flt3 ligand (FL)  Home-made
Polybrene  Sigma-Aldrich  TR-1003-G
Puromycin  Invivogen  ant-pr-1
shId2 (GCTTATGTCGAATGATAGCAA/TRCN0000054390) The RNAi Consortium (TRC)
shLacZ (CGCGATCGTAATCACCCGAGT/TRCN0000072224) The RNAi Consortium (TRC)
shTcf4 (GCTGAGTGATTTACTGGATTT/TRCN0000012094) The RNAi Consortium (TRC)

Tags

Play Video

Diesen Artikel zitieren
Short Hairpin RNA-Mediated Gene Knockdown in iHSPCs In Vitro: A Lentivirus-Based shRNA Expression System Delivery into iHSPCs for Knockdown of Specific Gene Expression. J. Vis. Exp. (Pending Publication), e20969, doi: (2023).

View Video