A Non-Coding Small RNA MicC Contributes to Virulence in Outer Membrane Proteins in <em>Salmonella</em> Enteritidis

Xia Meng; Weiwei Cui; Xianchen Meng; Jianye Wang; Jinqiu Wang; Guoqiang Zhu

doi:10.3791/61808

JoVE Journal > Immunology and Infection

免疫与感染

A Non-Coding Small RNA MicC Contributes to Virulence in Outer Membrane Proteins in Salmonella Enteritidis

Published: January 27, 2021

doi:

10.3791/61808

Xia Meng*^1,2, Weiwei Cui*¹, Xianchen Meng¹, Jianye Wang^1,2, Jinqiu Wang³, Guoqiang Zhu^1,2

¹College of Veterinary Medicine,Yangzhou University, ²Jiangsu Co-innovation Center for Prevention and Control of Important Animal Infectious Diseases and Zoonoses, ³Department of Animal Husbandry and Veterinary Medicine,Beijing Agricultural Vocational College

Summary

An λ-Red-mediated recombination system was used to create a deletion mutant of a small non-coding RNA micC.

Abstract

A non-coding small RNA (sRNA) is a new factor to regulate gene expression at the post-transcriptional level. A kind of sRNA MicC, known in Escherichia coli and Salmonella Typhimurium, could repress the expression of outer membrane proteins. To further investigate the regulation function of micC in Salmonella Enteritidis, we cloned the micC gene in the Salmonella Enteritidis strain 50336, and then constructed the mutant 50336ΔmicC by the λ Red-based recombination system and the complemented mutant 50336ΔmicC/pmicC carrying recombinant plasmid pBR322 expressing micC. qRT-PCR results demonstrated that transcription of ompD in 50336ΔmicC was 1.3-fold higher than that in the wild type strain, while the transcription of ompA and ompC in 50336ΔmicC were 2.2-fold and 3-fold higher than those in the wild type strain. These indicated that micC represses the expression of ompA and ompC. In the following study, the pathogenicity of 50336ΔmicC was detected by both infecting 6-week-old Balb/c mice and 1-day-old chickens. The result showed that the LD₅₀of the wild type strain 50336, the mutants 50336ΔmicC and 50336ΔmicC/pmicC for 6-week-old Balb/c mice were 12.59 CFU, 5.01 CFU, and 19.95 CFU, respectively. The LD₅₀ of the strains for 1-day-old chickens were 1.13 x 10⁹ CFU, 1.55 x 10⁸ CFU, and 2.54 x 10⁸ CFU, respectively. It indicated that deletion of micC enhanced virulence of S. Enteritidis in mice and chickens by regulating expression of outer membrane proteins.

Introduction

Non-coding small RNAs (sRNAs) are 40-400 nucleotides in length, which generally do not encode proteins but could be transcribed independently in bacterial chromosomes¹^,²^,³. Most sRNAs are encoded in the intergenic regions (IGRs) between gene-coding regions and interact with target mRNAs through base-pairing actions, and regulate target genes expression at the post-transcriptional level⁴^,⁵. They play important regulation roles in substance metabolism, outer membrane protein synthesis, quorum sensing and virulence gene expression⁵.

MicC is a 109-nucleotide small RNA transcript present in Escherichia coli and Salmonella enterica serovar Typhimurium, which could regulate multiple outer membrane protein expression such as OmpC, OmpD, OmpN, Omp35 and Omp36⁶^,⁷^,⁸^,⁹. MicC regulates the expression of OmpC by inhibiting ribosome binding to the ompC mRNA leader in vitro and it requires the Hfq RNA chaperone for its function in Escherichia coli⁶. In Salmonella Typhimurium, MicC silences ompD mRNA via a ≤12-bp RNA duplex within the coding sequence (codons 23-26) and then destabilizes endonucleolytic mRNA⁷. This regulation process is assisted by chaperone protein Hfq¹⁰. The OmpC is an abundant outer membrane protein that was thought to be important in environments where nutrient and toxin concentrations were high, such as in the intestine⁶. The OmpD porin is the most abundant outer membrane protein in Salmonella Typhimurium and represents about 1% of total cell protein¹¹. OmpD is involved in adherence to human macrophages and intestinal epithelial cells¹². MicC also represses the expression of both OmpC and OmpD porins. It is thought that MicC may regulate virulence. To explore new target genes regulated by MicC and study the virulence regulation function of micC, we cloned the micC gene in the Salmonella Enteritidis (SE) strain 50336, and then constructed the mutant 50336ΔmicC and the complemented mutant 50336ΔmicC/pmicC. Novel target genes were screened by qRT-PCR. The virulence of 50336ΔmicC was detected by mice and chicken infections.

Protocol

All the experiments were conducted in accordance with the Guide for the Care and Use of Laboratory Animals of the National Research Council. The animal care and use committee of Yangzhou University approved all experiments and procedures applied on the animals (SYXK2016-0020).

1. Bacterial strains, plasmids, and culture conditions

Use the bacteria and plasmids listed in Table 1.
Culture bacteria in LB broth or on LB agar plates at 37 °C, in the presence of 50 µg/mL ampicillin (Amp) when appropriate.
Culture strains containing temperature sensitive plasmids are used for deletion mutant construction at 30 °C.

2. Clone micC gene of S. Enteritidis strain 50336

Based on the upstream and downstream sequence of micC gene of S. Typhimurium strain SL1344, design primers vmicC-F and vmicC-R to amplify a fragment containing micC gene by PCR using SE50336 genomic DNA as template.
Mix 5 µL of 10x PCR reaction buffer, 2 µL of dNTP mixture (2.5 mM), 1 µL of vmicC-F and vmicC-R primers, respectively, 5 µL of template, 1 µL of Taq DNA polymerase and 35 µL of ddH₂O together for PCR.
Use the following PCR reaction conditions:pre-denaturation at 94 ˚C for 4 min; 94 ˚C for 30 s, 53 ˚C for 1 min, 72 ˚C for 1 min for 25 cycles, and extension at 72 ˚C for 10 min.
Sequence the PCR product to obtain the micC gene sequence.

3. Construction of the micC deletion mutant

NOTE: The micC-negative mutant of Salmonella Enteritidis strain 50336 was constructed using λ-Red-mediated recombination as described previously¹³^,¹⁴. The primers used are listed in Table 2.

Amplify chloramphenicol cassette containing homology fragments of micC gene.
1. Design micC-F and micC-R primers to amplify the chloramphenicol (Cm) cassette from plasmid pKD3, including 50 bp homology extensions from the 5' and 3' of the micC gene.
2. Extract the pKD3 plasmid as the PCR template.
3. Mix 5 µL of 10x PCR reaction buffer, 2 µL of dNTP Mixture (2.5 mM), 1 µL of micC-F and micC-R primers, respectively, 5 µL of template, 1 µL of Taq DNA polymerase and 35 µL of ddH₂O together as PCR reaction mixture
4. Amplify the Cm cassette with the following PCR reaction conditions: pre-denaturation at 94 °C for 4 min; 94 °C for 1 min, 52 °C for 1 min, 72 °C for 1 min for 10 cycles; 94 °C for 1 min, 63 °C for 1 min, 72 °C for 1 min for 25 cycles, and extension at 72 °C for 10 min.
5. Detect the size of PCR product by agarose gel electrophoresis. Purify and recover PCR product with DNA gel recovery kit, and determine the concentration of DNA by spectrophotometer.
  CAUTION: PCR must be carried out twice. The first PCR product was diluted at a ratio of 1:200 and used as a template for the secondary PCR, to eliminate the interference of further recombination by pKD3 plasmid.
Construct 1^st recombinant strain 50336ΔmicC::cat
1. Mix 100 µL of SE50336 competent cells with 5 µL of pKD46 plasmid uniformly and incubate on ice for 30 min. Heat shock the above mixture at 42 °C for 90 s, and rapidly transfer the mixture to ice for 2 min to transform the pKD46 plasmid to SE50336. Screen positive colonies by culturing overnight at 30 °C on an Amp (50 µg/mL) resistant plate.
2. Add 30 mM L-arabinose to SE50336/pKD46 liquid culture, and induce recombinase expression by a 30 °C shaking culture for 1 h. Then prepare competent cells.
3. Mix 100 ng of purified PCR product (step 3.1) and 40 µL of SE50336/pKD46 competent cells into an electric shock cup (e.g., Bio-Rad). Carry out electric shock transformation with the parameters of voltage 1.8 kV, pulse 25 µF and resistance 200 Ω.
4. After electrotransformation, transfer the mixture to 1 mL of SOC medium and a shaking culture at 150 rpm and 30 °C for 1 h. Then smear the mixture on a Cm (34 µg/mL) resistant LB plate and culture at 37 °C overnight to screen positive colony.
5. Culture the above positive colony at 42 °C for 2 h. Screen the colony that is sensitive to Amp (50 µg/mL) but resistant to Cm (34 µg/mL) at 37 ˚C overnight to obtain the 1st recombinant strain without pKD46.
Identify the 1st recombinant strain 50336ΔmicC::Cat.
1. Extract 50336ΔmicC::Cat genomic DNA as the PCR template. Use the same PCR reaction components as in step 2.1. Carry out the PCR reaction with the same conditions as in step 2.1.
2. Detect the size of PCR product by agarose gel electrophoresis and sequence the PCR product.
Construct deletion mutant 50336ΔmicC.
1. Electroporate 100 ng of plasmid pCP20 into 40 µL of 50336ΔmicC::Cat competent cells with the parameters of voltage 1.8 kV, pulse 25 µF and resistance 200 Ω, screen positive transformants on both Amp (50 µg/mL) and Cm (34 µg/mL) resistant plate at 30 °C.
2. Transfer above positive transformants into non-resistant LB and culture them overnight at 42 °C, and then isolate single colonies on an LB plate at 37 °C. Select the colony that is sensitive to both Amp and Cm. This mutant is the micC deletion mutant SE50336ΔmicC.
3. Verify 50336ΔmicC by PCR.
  1. Extract 50336ΔmicC genomic DNA as PCR template. Mix 5 µLof 10x PCR reaction buffer, 2 µL of dNTP Mixture (2.5 mM), 1 µL of primer vmicC-F, 1 µL of primer vmicC-R, 5 µL of template, 1 µL of Taq DNA polymerase and 35 µL of ddH₂O together for PCR.
  2. Use the following PCR reaction conditions:pre-denaturation at 94 °C for 4 min; 94 °C for 30 s, 53 °C for 1 min, 72 ˚C for 1 min for 25 cycles, and extension at 72 °C for 10min.

4. Construction of the micC complemented strain

Design primers pBR-micC-F and pBR-micC-R with NheI and SalI restriction sites.
1. Amplify full-length micC gene with flank sequences using PCR reaction mixture that contains 5 µL of SE50336 genomic DNA as template, primers 1 µL of pBR-micC-F and 1 µL of pBR-micC-R as primers, 5 µLof 10x PCR reaction buffer, 2 µL of dNTP Mixture (2.5 mM), 2 µL of dNTP Mixture (2.5 mM) and 35 µL of ddH₂O.
2. Use the following PCR reaction conditions: pre-denaturation at 94 °C for 4 min; 94 °C for 30 s, 52 °C for 50 s, 72 °C for 1 min for 25 cycles, and extension at 72 °C for 10 min. Purify and recover PCR product.
Digest PCR product and plasmid pBR322 respectively using restriction enzyme NheI and SalI, and ligate them using T4 ligase at 16 °C overnight to obtain the plasmid pBR322-micC.
Transform pBR322-micC into the SE50336ΔmicC competent cells, and screen positive transformant to obtain the complemented strain SE50336ΔmicC/pmicC. Extract plasmid pBR322-micC from complemented strain and verify it by restriction enzyme digestion and sequencing.

5. RNA isolation and quantitative real-time PCR

Culture SE50336, 50336ΔmicC, and 50336ΔmicC/pmicC in LB medium overnight at 24 °C with 180 rpm shake cultivation to an OD₆₀₀ of 2.0. Collect bacterial culture by centrifugation at 13000 rpm for 2 min.
Extract total RNA using TRIzol reagent. Incubate 50 µL of isolated RNA with 2 µL of DNaseI and 6 µL of 10x buffer at 37 °C for 30 min to remove DNA. Determine RNA quantity by pipetting 1 µL of RNA sample to a micro-spectrophotometer.
Synthesis of cDNA
1. Use 1 µg of total RNA for cDNA synthesis in 20 µL of reverse transcription reaction system (4 µL of 5x buffer, 1 µL of RT Enzyme mix, 1 µL of RT primer mix, 10 µL of total RNA, and 4 µL of ddH₂O). Incubate above reaction system at 37 °C for 15 min and then at 85 °C for 5 s.
Design primers based on the sequence of target genes ompA, ompC and ompD. Perform reverse transcription-PCR using a RT reagent kit. The PCR reaction components contain 2.5 µLof 10x PCR reaction buffer, 1 µL of dNTP mixture (2.5 mM), 1 µL of target gene (ompA, ompC or ompD) primers, 2.5 µL of template, 0.5 µL of Taq DNA polymerase and 17.5 µL of ddH₂O.
1. Use the following PCR reaction conditions:pre-denaturation at 94 °C for 4 min; 94 °C for 30 s, 60 °C for 1 min, 72 °C for 1 min for 25 cycles, and extension at 72 °C for 10min.
Carry out real-time PCR using SYBR green RT-PCR kit in a RT-PCT instrument in triplicates.
1. Use the following PCR reaction components: 10 µL of 2x SYBR buffer, 0.4 µLof forward primer and reverse primer respectively, 0.4 µL of RoxDye II, 2 µLof cDNA and 6.8 µL of RNase free H₂O.
2. Use the following PCR reaction conditions:pre-denaturation at 95 °C for 1 min for one cycle; 95 °C for 5 s, 60 °C for 34 s for 40 cycles.
3. Normalize all data to the endogenous reference gene gyrA. Use 2^-Δ^Δ^CT method for data quantification¹⁵.

6. Virulence assays

Culture SE50336, 50336ΔmicC and 50336ΔmicC/pmicC in LB medium to early stationary phase (OD₆₀₀ of 2-3) at 24 ˚C, harvest by centrifugation, and dilute to appropriate CFU mL^-1 in sterile PBS.
For mice infections, dilute the cultured strains to 10 CFU/200 µL, 10² CFU/200 µL and 10³ CFU/200 µL gradient resuspensions. Infect groups of five 6-8 week old Balb/c mice per strain by subcutaneous injection. Inject the control group with 200 µL of physiological saline.
For chicken infections, dilute above three strains to 10⁷CFU/200 µL, 10⁸CFU/200 µL and 10⁹CFU/200 µL gradient resuspensions. Infect groups of twenty 1-day-old chickens per strain by subcutaneous injection.
Monitor signs of illness and deaths of experimental animals daily. Calculate the LD₅₀ (median lethal dose) 14 d post-infection as described previously¹⁶. Process the data using data analysis software.
In infection groups, collect the heart, liver, spleen, lung, and kidney of freshly dead chicks. Weigh 0.5 g of the above tissues separately and grind them with sterile operation. Dilute grinding samples gradually, spread them on LB plate and culture for 8-10 h at 37 ˚C. Record the amount of Salmonella strains colonized in chick tissues.

Representative Results

Construction of the mutant 50336ΔmicC and complemented strain 50336ΔmicC /pmicC
The micC gene clone result indicated that this gene was composed of 109 bp showing 100% identity with that of S. Typhimurium. Based on the sequence data, the deletion mutant 50336ΔmicC and the complemented mutant 50336ΔmicC/pmicC were constructed successfully. In detail, sequencing results showed that a 1.1 kb Cm resistance cassette was amplified and used for constructing the 1^st recombinant. The 1^st recombinant 50336ΔmicC::cat was validated by PCR using primers vmicC-F and vmicC-R with an expected band size of about 1200 bp of PCR products with Cm insertion compared to 279 bp of PCR products in wild type strain (Figure 1). In the second recombination, Cm cassette was eliminated by pCP20. The PCR results combined with sequencing confirmed that the isogenic micC mutant was constructed successfully and named as 50336ΔmicC (Figure 1).

MicC regulates ompA, ompC, and ompD gene expression
To determine the targets of MicC, the expression of ompA, ompC and ompD genes in SE strains 50336, 50336ΔmicC and 50336ΔmicC/pmicC were analyzed by real-time quantitative PCR using gyrA as the normalizing internal standard. The results showed that transcription of ompA and ompC in 50336ΔmicC increased about 2.2-fold and 3-fold than those in the wild type strain, while ompD in 50336ΔmicC was increased slightly (1.3-fold) than that in wild type strain (Figure 2). It indicated that micC could repress the expression of ompA, ompC and ompD. OmpA was probably a potential novel target gene regulated by micC directly.

Deleting micC enhances S. Enteritidisvirulence in mice and chickens
We performed LD₅₀ assays to quantify the impact of deleting micC on S. Enteritidis virulence in mice and chickens. After infecting 6-8 week old Balb/c mice with 10³CFU of each of the three strains, we observed that the most mice infected by 50336ΔmicC displayed lassitude, inappetence or diarrhea 48 h post infection, and appeared to die in succession 96 h post infection. While the mice infected by WT strain and 50336ΔmicC/pmicC displayed the above symptoms 72 h post infection, and were dead 120 h post infection. The LD₅₀s were calculated 7 d post-infection. The results showed that the LD₅₀of the WT strain 50336, 50336ΔmicC and 50336ΔmicC/pmicC for mice were 12.59, 5.01 and 19.95 CFU, respectively. It indicated that the virulence of the mutant 50336ΔmicC enhanced 2.5-fold as compared with WT in mice (Table 3). After infecting 1-day-old chickens with 10⁹ CFU of each of the three strains, most chickens displayed intestinal hyperemia and diarrhea 10 h post infection. When infected with 10⁸ CFU, the chickens infected with 50336ΔmicC showed higher mortality, as compared with WT strain and 50336ΔmicC/pmicC. The LD₅₀s were calculated for 14 d post-infection. The results showed that the LD₅₀of the WT strain 50336, 50336ΔmicC, and 50336ΔmicC/pmicC for chickens were 1.13×10⁹, 1.55×10⁸ and 2.54×10⁸ CFU, respectively. It indicated that deletion of micC also enhanced virulence of S. Enteritidis in chickens. All three strains of S. Enteritidis were recovered from the liver, spleen, and caecum of the infected chickens.

Figure 1: PCR verification of the 50336ΔmicC mutants with primers vmicC-F and vmicC-R. A 280 bp PCR product was obtained when the wild-type 50336 genome as template (lane 1). When the Cm cassette gene was inserted to genome of S. Enteritidis, the 1^st recombinant 50336Δmic::cat was verified by PCR and a 1100 bp PCR product was obtained (lane 2). The Cm cassette gene of 50336Δmic::cat was excised by introducing the FLP recombinase-expressing vector pCP20 and the 2^nd recombinant 50336Δmic was obtained and verified by PCR (lane 3). M: molecular mass marker. Please click here to view a larger version of this figure.

Figure 2: Fold changes of ompA, ompC and ompD genes mRNA level were determined in the mutant 50336Δmic and complemented strain 50336Δmic/pmic by quantitative RT-PCR compared to the wild type strain. Assays were performed in triplicate. The 2^-ΔΔCT method was used for data quantification. *Indicates statistically significant difference compared with the wild type strain (p<0.05) Please click here to view a larger version of this figure.

Strains/plasmids	Characteristics	References
Strains
CMCC(B)50336	Salmonella enterica serovar Enteritidis wild-type	NICPBP, China
50336ΔmicC	micC deficient mutant	This study
50336ΔmicC/pmicC	50336ΔmicC carrying pBR- micC (Amp^r)	This study
Plasmids:
pKD3	Cm^r; Cm cassette teplate	[13]
pKD46	Amp^r, λRed recombinase expression	[13]
pCP20	Amp^r, Cm^r; Flp recombinase expression	[13]
pBR-micC	pBR322 carrying the full micC gene (Amp^r)	This study
pGEM-T Easy	cloning vector, Amp^r	Takara
pMD19 T-simple	cloning vector, Amp^r	Takara

Table 1. Bacterial strains and plasmids used in this study.

Primer	Sequence (5'-3')	Product size (bp)
micC-F	TGTCAGGAAAGACCTAAAAAGAGATGTTACCGTTTAATTCAATAATTAATTGTGTAGGCTGGAGCTGCTTCG	1114
micC -R	TGGAAATAAAAAAAGCCCGAACATCCGTTCGGGCTTGTCAATTTATACCATATGAATATCCTCCTTAG
vmicC -F	AGCGAGTTGACGTTAAAACGTTAT	279/140
vmicC -R	TTCGTTCGGGCTTGTCAATTTATA
pBR-micC-F	CAGGCTAGCCACTTTATGTACAATGACATACGTCAC	434
pBR-micC-R	CAGGTCGACAAATATTCTAAGGATTAACCTGGAAAC
ompA-F	ACTGAACGCCCTGAGCTTTA	177
ompA-R	ACACCGGCTTCATTCACAAT
ompC-F	AAAGTTCTGCGCTTTGTTGG	187
ompC-R	CGCTGACGAACACCTGTATG
ompD-F	ACGGTCAGACTTCGCATAGG	184
ompD-R	TGTTGCCACCTACCGTAACA
gyrA-F	GCATGACTTCGTCAGAACCA	278
gyrA-R	GGTCTATCAGTTGCCGGAAG

Table 2. Primers used in this study

Strains	LD₅₀for mice (CFU)	Fold enhancement	LD₅₀for chickens (CFU)	Fold enhancement
S. Enteritidis 50336	12.59	1	1.13×10⁹	1
50336ΔmicC	5.01	2.51	1.55×10⁸	7.29
50336ΔmicC/pmicC	19.95	0.63	2.54×10⁸	4.45
Negative control	0	/	0	/

Table 3. Virulence properties of S. Enteritidis 50336 strains in mice and chickens

Discussion

S. Enteritidis is an important facultative intracellular pathogen that can infect young chickens and produces symptoms from enteritis to systemic infection and death¹⁷^,¹⁸. In addition, S. Enteritidis causes latent infections in adult chickens and chronic carriers contaminate poultry products, resulting in food-borne infections in humans¹⁹. The pathogenic mechanism of S. Enteritidis remains to be further probed. To date, some sRNAs such as IsrJ, SroA and IsrM have been found to affect Salmonella virulence²⁰^,²¹^,²²^,²³. The non-coding small RNA micC gene was identified in many Enterobacteria such as Escherichia coli, Salmonella Typhimurium, Salmonella Bongori and Shigella flexneri⁶^,⁷^,²⁴. Here, we found that the sequence of micC in S. Enteritidis 50336 was the same as that in S. Typhimurium. It indicates that MicC is a conservative sRNA in Enterobacteria.

To investigate whether MicC mediates virulence in S. Enteritidis for animals and identify MicC targets, we constructed the deletion mutant 50336ΔmicC and the complemented mutant 50336ΔmicC/pmicC expressing micC successfully. The results of qRT-PCR indicated that micC could repress the expression of ompA and ompC.OmpA is probably a potential novel target of MicC. The sRNA RybB could repress the synthesis of OmpA by base-pairing with the 5' untranslated regions (5' UTRs) of target ompA mRNA²⁵. The MicA sRNA also facilitates rapid decay of the ompA mRNA by antisense pairing similarly to RybB²⁵^,²⁶. Whether MicC uses the similar regulation mechanism to regulate ompA is not known and remains to be studied in the near future. In E. coli, the deletion of MicC increased the expression of ompC 1.5- to 2-fold. Further study showed that MicC was shown to inhibit ribosome binding to the ompC mRNA 5' leader⁶. In addition, Pfeiffer found that OmpC was the main targets of MicC⁷. It is supposed that MicC regulates ompC in a similar mechanism in S. Enteritidis with that in E. coli and S. Typhimurium. Besides OmpA and OmpC, MicC could also repress the expression of OmpD. The result showed that the transcription of ompD in 50336ΔmicC was increased slightly (1.3-fold) than that in wild type strain. Based on the above results, it demonstrated that MicC could repress the transcription of multiple target mRNAs (ompA, ompC and ompD) in S. Enteritidis. MicC is not the only one sRNA that can regulate multiple targets. Some sRNAs such as RybB, DsrA, GcvB, RNAIII and RyhB also act upon multiple targets²⁵^,²⁷^,²⁸^,²⁹^,³⁰^,³¹. Because sRNAs regulate targets by base-pairing mechanism to accomplish sRNA-target interactions³², it is possible that conserved sub-regions or domains of sRNAs can bind to different targets.

The outer membrane of Gram-negative bacteria is a key interface in host-pathogen interactions. OmpA, OmpC and OmpD are all important and abundant outer membrane proteins. OmpC plays an important role in abominable environment such as in the intestine⁶. OmpD is involved in adherence to human macrophages and intestinal epithelial cells¹². It was thought that the change of OMPs expression caused by MicC deletion could influence the virulence of S. Enteritidis, and MicC accumulated in stationary-phase cells and especially under growth conditions induced the Salmonella SPI-1 and SPI-2 virulence genes⁷. It is thought that MicC is related to virulence in Salmonella, while animal infections experiments were performed to detect virulence of MicC. The results showed that the LD₅₀of the mutants 50336ΔmicC for 1-day-old chickens and 6-week-old Balb/c mice were both declined obviously compared with the wild type strain. It indicated that the deletion of micC enhanced virulence of S. Enteritidis in mice and chickens. It is supposed that the increase of OmpA, OmpC and OmpD expression, which is caused by MicC deletion lead to virulence enhancement in S. Enteritidis.

MicC negatively regulates S. Enteritidis virulence in mice and chickens probably by downregulating expression of the major outer membrane proteins OmpA and OmpC.

Disclosures

The authors have nothing to disclose.

Acknowledgements

This study was supported by grants from the Chinese National Science Foundation (Nos. 31972651 and 31101826), Jiangsu High Education Science Foundation (No.14KJB230002), State Key Laboratory of Veterinary Biotechnology (No.SKLVBF201509), Nature Science Foundation Grant of Yangzhou (No.YZ2014019), A Project Funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD).

Materials

dextrose	Sangon Biotech	A610219	for broth preparation
DNA purification kit	TIANGEN	DP214	for DNA purification
Ex Taq	TaKaRa	RR01A	PCR
KH₂PO₄	Sinopharm Chemical Reagent	10017608	for broth preparation
K₂HPO₄	Sinopharm Chemical Reagent	20032116	for broth preparation
L-Arabinose	Sangon Biotech	A610071	λ-Red recombination
Mini Plasmid Kit	TIANGEN	DP106	plasmid extraction
NaCl	Sinopharm Chemical Reagent	10019308	for broth preparation
(NH₄)₂SO₄	Sinopharm Chemical Reagent	10002917	for broth preparation
PrimeScript^RRT reagent Kit with gDNA Eraser	TaKaRa	RR047	qRT-PCR
SYBR^R Premix Ex Taq II	TaKaRa	RR820	qRT-PCR
T4 DNA Ligase	NEB	M0202	Ligation
TRIzol	Invitrogen	15596018	RNA isolation
Tryptone	Oxoid	LP0042	for broth preparation
Yeast extract	Oxoid	LP0021	for broth preparation
centrifuge	Eppendorf	5418	centrifugation
Electrophoresis apparatus	Bio-Rad	164-5050	Electrophoresis
Electroporation System	Bio-Rad	165-2100	for bacterial transformation
Spectrophotometer	BioTek	Epoch	Absorbance detection
Real-Time PCR system	Applied Biosystems	7500 system	qRT-PCR

References

Jørgensen, M. G., Pettersen, J. S., Kallipolitis, B. H. sRNA-mediated control in bacteria: An increasing diversity of regulatory mechanisms. Biochimica et Biophysica Acta-Gene Regulatory Mechanisms. 1863 (5), 194504 (2020).
Wagner, E. G. H., Romby, P. Small RNAs in bacteria and archaea: who they are, what they do, and how they do it. Advances In Genetics. 90, 133-208 (2015).
Vogel, J. A rough guide to the non-coding RNA world of Salmonella. Molecular Microbiology. 71 (1), 1-11 (2009).
Dutta, T., Srivastava, S. Small RNA-mediated regulation in bacteria: A growing palette of diverse mechanisms. Gene. 656, 60-72 (2018).
Waters, L. S., Storz, G. Regulatory RNAs in bacteria. Cell. 136 (4), 615-628 (2009).
Chen, S., Zhang, A., Blyn, L. B., Storz, G. MicC, a second small-RNA regulator of Omp protein expression in Escherichia coli. Journal of Bacteriology. 186 (20), 6689-6697 (2004).
Pfeiffer, V., Papenfort, K., Lucchini, S., Hinton, J. C., Vogel, J. Coding sequence targeting by MicC RNA reveals bacterial mRNA silencing downstream of translational initiation. Nature Structural & Molecular Biology. 16 (8), 840-846 (2009).
Dam, S., Pagès, J. M., Masi, M. Dual Regulation of the Small RNA MicC and the Quiescent Porin OmpN in Response to Antibiotic Stress in Escherichia coli. Antibiotics (Basel). 6 (4), 33 (2017).
Hao, M., et al. Porin Deficiency in Carbapenem-Resistant Enterobacter aerogenes Strains. Microbial Drug Resistance. 24 (9), 1277-1283 (2018).
Wroblewska, Z., Olejniczak, M. Hfq assists small RNAs in binding to the coding sequence of ompD mRNA and in rearranging its structure. RNA. 22 (7), 979-994 (2016).
Santiviago, C. A., Toro, C. S., Hidalgo, A. A., Youderian, P., Mora, G. C. Global regulation of the Salmonella enterica serovar typhimurium major porin, OmpD. Journal of Bacteriology. 185 (19), 5901-5905 (2003).
Hara-Kaonga, B., Pistole, T. G. OmpD but not OmpC is involved in adherence of Salmonella enterica serovar typhimurium to human cells. Canadian Journal of Microbiology. 50 (9), 719-727 (2004).
Datsenko, K. A., Wanner, B. L. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proceedings of the National Academy of Sciences of the United States of America. 97 (12), 6640-6645 (2000).
Meng, X., et al. The RNA chaperone Hfq regulates expression of fimbrial-related genes and virulence of Salmonella enterica serovar Enteritidis. FEMS Microbiology Letters. 346 (2), 90-96 (2013).
Livak, K. J., Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 25 (4), 402-408 (2001).
Vander Velden, A. W., Bäumler, A. J., Tsolis, R. M., Heffron, F. Multiple fimbrial adhesins are required for full virulence of Salmonella typhimurium in mice. Infection and Immunity. 66 (6), 2803-2808 (1998).
Prescott, J. F. Salmonella enterica serovar enteritidis in humans and animals: Epidemiology, pathogenesis, and control. Canadian Veterinary Journal La Revue Veterinaire Canadienne. 40 (10), 736 (1999).
Balasubramanian, R., et al. The global burden and epidemiology of invasive non-typhoidal. Hum Vaccin Immunother. 15 (6), 1421-1426 (2019).
De Buck, J., Van Immerseel, F., Haesebrouck, F., Ducatelle, R. Colonization of the chicken reproductive tract and egg contamination by Salmonella. Journal of General and Applied Microbiology. 97 (2), 233-245 (2004).
Padalon-Brauch, G., et al. Small RNAs encoded within genetic islands of Salmonella typhimurium show host-induced expression and role in virulence. Nucleic Acids Research. 36 (6), 1913-1927 (2008).
Santiviago, C. A., et al. Analysis of pools of targeted Salmonella deletion mutants identifies novel genes affecting fitness during competitive infection in mice. PLoS Pathogens. 5 (7), 1000477 (2009).
Gong, H., et al. A Salmonella small non-coding RNA facilitates bacterial invasion and intracellular replication by modulating the expression of virulence factors. PLoS Pathogens. 7 (9), 1002120 (2011).
Hébrard, M., et al. sRNAs and the virulence of Salmonella enterica serovar Typhimurium. RNA Biology. 9 (4), 437-445 (2012).
Vogel, J., Papenfort, K. Small non-coding RNAs and the bacterial outer membrane. Current Opinion in Microbiology. 9 (6), 605-611 (2006).
Papenfort, K., et al. SigmaE-dependent small RNAs of Salmonella respond to membrane stress by accelerating global omp mRNA decay. Molecular Microbiology. 62 (6), 1674-1688 (2006).
Udekwu, K. I., et al. Hfq-dependent regulation of OmpA synthesis is mediated by an antisense RNA. Genes and Development. 19 (19), 2355-2366 (2005).
Papenfort, K., Vogel, J. Multiple target regulation by small noncoding RNAs rewires gene expression at the post-transcriptional level. Research in Microbiology. 160 (4), 278-287 (2009).
Lease, R. A., Cusick, M. E., Belfort, M. Riboregulation in Escherichia coli: DsrA RNA acts by RNA:RNA interactions at multiple loci. Proceedings of the National Academy of Sciences of the United States of America. 95 (21), 12456-12461 (1998).
Sharma, C. M., Darfeuille, F., Plantinga, T. H., Vogel, J. A small RNA regulates multiple ABC transporter mRNAs by targeting C/A-rich elements inside and upstream of ribosome-binding sites. Genes and Development. 21 (21), 2804-2817 (2007).
Boisset, S., et al. Staphylococcus aureus RNAIII coordinately represses the synthesis of virulence factors and the transcription regulator Rot by an antisense mechanism. Genes and Development. 21 (11), 1353-1366 (2007).
Massé, E., Vanderpool, C. K., Gottesman, S. Effect of RyhB small RNA on global iron use in Escherichia coli. Journal of Bacteriology. 187 (20), 6962-6971 (2005).
Papenfort, K., Vogel, J. Regulatory RNA in bacterial pathogens. Cell Host & Microbe. 8 (1), 116-127 (2010).

Play Video

PDF

DOI

DOWNLOAD MATERIALS LIST

Cite This Article

Meng, X., Cui, W., Meng, X., Wang, J., Wang, J., Zhu, G. A Non-Coding Small RNA MicC Contributes to Virulence in Outer Membrane Proteins in Salmonella Enteritidis. J. Vis. Exp. (167), e61808, doi:10.3791/61808 (2021).