מותנה הגנטי Transsynaptic איתור במוח העכבר עוברי
Summary
Capitalizing on a binary genetic strategy we provide a detailed protocol for neural circuit tracing in mice that express complementary transsynaptic tracers after Cre-mediated recombination. Because cell-specific tracer production is genetically encoded, our experimental approach is suitable to study the formation and maturation of neural circuitry during murine embryonic brain development at a single cell resolution.
Abstract
Anatomical path tracing is of pivotal importance to decipher the relationship between brain and behavior. Unraveling the formation of neural circuits during embryonic maturation of the brain however is technically challenging because most transsynaptic tracing methods developed to date depend on stereotaxic tracer injection. To overcome this problem, we developed a binary genetic strategy for conditional genetic transsynaptic tracing in the mouse brain. Towards this end we generated two complementary knock-in mouse strains to selectively express the bidirectional transsynaptic tracer barley lectin (BL) and the retrograde transsynaptic tracer Tetanus Toxin fragment C from the ROSA26 locus after Cre-mediated recombination. Cell-specific tracer production in these mice is genetically encoded and does not depend on mechanical tracer injection. Therefore our experimental approach is suitable to study neural circuit formation in the embryonic murine brain. Furthermore, because tracer transfer across synapses depends on synaptic activity, these mouse strains can be used to analyze the communication between genetically defined neuronal populations during brain development at a single cell resolution. Here we provide a detailed protocol for transsynaptic tracing in mouse embryos using the novel recombinant ROSA26 alleles. We have utilized this experimental technique in order to delineate the neural circuitry underlying maturation of the reproductive axis in the developing female mouse brain.
Introduction
מעקב נתיב האנטומי הוא אחד הכלים הנפוצים ביותר בשימוש לפענח את הקשר בין המוח והתנהגות 1. קידום בטכנולוגיות מעגל התחקות עצביות העניק מדעני מוח עם היכולת לעקוב אחר מעגלים עצביים מאוכלוסיות נוירון זיהו גנטי בעכברים 2. למרות התקדמות הטכנולוגית אלה נותרים מאתגרים לפענח את היווצרותם של מעגלים עצביים במיוחד בתקופת התבגרות עוברית. סיבה לכך הוא שרוב שיטות המעקב שפותחו עד היום מבוססים על הזרקת stereotaxic של קליעים נותבים transsynaptic או וירוסי neurotropic מהונדסים גנטי (איור 1) 2,3. בעוד טכניקות אלה להשיג רזולוציה מרחב ובזמן של קישוריות, כמה מגבלות מובנות כגון זריקות נותב מאתגרות מבחינה טכנית למוח המתפתח, שחזור של אתר הזרקה, דלקת פוטנציאלית במקום ההזרקה וimpor ביותרcytotoxicity tantly נגרמת על ידי וירוסי neurotropic להגביל את השימוש בם 4.
שיטה חלופית היא להביע קליעים נותבים transsynaptic כtransgenes בעכברים שעברו מוטציה גנטית. יש לנו לאחרונה שונו בטכניקה זו ופיתחתי מערכת בינארית transsynaptic גנטי התחקות למפות את המעגלים העצביים של כל אוכלוסייה עצבית מזוהה גנטי 5. האסטרטגיה הניסיונית שלנו מבוססת על שני זנים חדשים לדפוק בעכבר, המבטאים גם לקטינים שעורה נותב דו-כיווני (BL) 6 או בר רעלנים נותב מדרדר C התמזג GFP (GTT) 7 מלוקוס ROSA 26 לאחר Cre תיווך רקומבינציה. כאן אנו משמשים זני עכבר אלו כדי להביע את BL וGTT בתאי עצב המייצרים kisspeptin, neuropeptide שמעורב בויסות ההתבגרות של ציר הרבייה 8,9 באופן סלקטיבי. אנו מראים כי טכניקה זו היא מתאימה כדי לחזות את ההתפתחות והתבגרות של נשיקהמעגלים עצביים peptin במהלך התפתחות עוברית של מוח העכבר נקבת 5.
אסטרטגית רבייה
R26-BL-IRES-τlacZ (BIZ) והקווים נותב R26-GFP-TTC (GTT) הם לדפוק בזנים 5 שנושאים אללים ROSA26 רקומביננטי. R26-BIZ ואללים R26-GTT הם תעתיק שקטים בשל נוכחותם של איתות חזקה תעתיק תחנה, שמעוטרת בשני אתרי loxP 5. ביטוי של transgene BIZ וGTT מופעל על ידי ההסרה בתיווך Cre של אות תחנת תעתיק. ניתן להשתמש אללים R26-BIZ וR26-GTT באופן עצמאי על ידי פשוט חצייה עם קו נהג Cre. להטרוזיגוטיים בעלי חיים ניתוח לאללים Cre וR26 המתאימים ניתן להשתמש. המלטת ביצוע Cre אחד או אחת אלל R26, בהתאמה, צריכה לשמש כקבוצת ביקורת. לחלופין, אפשר גם ליצור triple לדפוק בבעלי חיים שנשאו את אללים Cre, R26-BIZ וR26-GTT, אולם זה יחייב צלב אחד נוסף.
Protocol
Representative Results
Discussion
יש להביע קליעים נותבים transsynaptic כtransgenes להתחקות המעגלים העצביים של אוכלוסיות נוירונים מוגדרות גנטי יש מספר יתרונות בהשוואה להזרקת stereotaxic של קליעים נותבים או וירוסי neurotopic. ראשית, נותב מופק כחלבון אנדוגני ולכן אינו מפיק כל תגובה חיסונית ומסלול עצבי סלקטיבית ניתן לנתח ב?…
Disclosures
The authors have nothing to disclose.
Acknowledgements
We thank Michael Candlish for critical comments on the manuscript. This project was supported by the Deutsche Forschungsgemeinschaft grants BO1743/6 and SFB/TRR 152 P11 and Z02 to Ulrich Boehm.
Materials
| Name of Material/ Equipment | Company | Catalog Number | Comments/Description |
| Bisbenzimide (Hoechst 33258 dye) | Sigma | 14530-100MG | |
| Ethanol | Sigma | 32205-1L | |
| Cryo mold (Peel-a-way) | Polyscience Inc. | 18646A-1 | 22mm x 22mm x 20mm |
| DMSO | Sigma | D8418-100ML | |
| Dimethyl Formamide (DMF) | VWR Chemicals | 23470,293 | |
| EGTA | ROTH | 3054.3 | |
| Fluoromount G | Southern Biotech | 0100-01 | |
| Glutaraldehyde | Sigma | G5882-50ML | |
| Hydrogen peroxide | Sigma | 34988-7 | |
| Isopentane (Methyl 2-butane) | Sigma | M32631-2.5L | |
| Kaiser's Glycine gelatin | Merck | 1092420100 | |
| Methanol | Sigma | 494437-1L | |
| MgCl2 | Sigma | M2670-100G | |
| NaCl | ROTH | HN00.2 | |
| NBT | Sigma | 298-83-9 | |
| Nonidet P40 substitute | Fluka | 743.85 | |
| OCT | Leica | 14020108926 | |
| PAP pen | Dako | S2002 | |
| Parafarmaldehyde | Sigma | P6148-1KG | |
| Sodium deoxycholate | Sigma | D6750-25G | |
| Sucrose | Sigma | S7903-1KG | |
| Superfrost slides | Thermo Scientific | FT4981GLPLUS | |
| TSA kit | PerkinElmer | NEL700 | |
| TSA plus kit | PerkinElmer | NEL749A001KT | |
| Tris | ROTH | AE15.2 | |
| Triton-X 100 | ROTH | 3051.2 | |
| Tween 20 | ROTH | 9127.1 | |
| X-gal | ROTH | 2315.1 | |
| Cryostat | Leica | na | |
| Light microscope equipped with DIC imaging | Zeiss | Axioskop2 equipped with Axio Vision software | |
| Fluroscence microscope | Zeiss | Axioskop2 equipped with Axio Vision software | |
| Photoshop | Adobe | PS6 | |
| Goat anti-WGA (recognizes BL) | Vector Laboatories | AS-2024 | |
| Biotinylayted horse anti-goat IgG | Vector Laboatories | BA-9500 | |
| Biotinylated goat anti-rabbit IgG | Vector Laboatories | BA-1000 | |
| Rabbit anti-GFP (recognizes GTT) | Invitrogen | A11122 | |
| Rabbit anti-GnRH | Affinity Bio Reagent | PA1-121 | |
| Dylight488-donkey anti-rabbit IgG | Thermo Scientific | SA5-10038 | |
| SA-Alexa Fluor 546 | Life Technologies | S-11225 | |
| Primers | |||
| BL Fwd (for BIZ genotyping) | Eurofins MWG Operon | ATGAAGATGATGAGCACCAG GGC |
|
| BL Rev (for BIZ genotyping) | Eurofins MWG Operon | AGCCCTCGCCGCAGAACTC | |
| Cre Fwd (for Cre genotyping) | Eurofins MWG Operon | GTCGATGCAACGAGTGATGAG GTTCG |
|
| Cre Rev (for Cre genotyping) | Eurofins MWG Operon | CCAGGCTAAGTGCCTTCTCTAC ACCTGC |
|
| TTC Fwd (for GTT genotyping) | Eurofins MWG Operon | AGCAAGGGCGAGGAGCTGTT | |
| TTC Rev (for GTT genotyping) | Eurofins MWG Operon | GTCTTGTAGTTGCCGTCGTCCT TGAA |
|
| XY Fwd (for gender genotyping) | Eurofins MWG Operon | TGAAGCTTTTGGCTTTGA | |
| XY Rev (for gender genotyping) | Eurofins MWG Operon | CCGCTGCCAAATTCTTTG | |
| ROSA26 Fwd | Eurofins MWG Operon | CGAAGTCGCTCTGAGTTGTTATC | |
| ROSA26 Rev | Eurofins MWG Operon | GCAGATGGAGCGGGAGAAAT | |
| SA Rev | Eurofins MWG Operon | CGAAGTCGCTCTGAGTTGTTATC | |
References
- Vercelli, A., Repici, M., Garbossa, D., Grimaldi, A. Recent techniques for tracing pathways in the central nervous system of developing and adult mammals. Brain. Res. Bull. 51, 11-28 (2000).
- Huang, Z. J., Zeng, H. Genetic approaches to neural circuits in the mouse. Annu. Rev. Neurosci. 36, 183-215 (2013).
- Lanciego, J. L., Wouterlood, F. G. A half century of experimental neuroanatomical tracing. J. Chem. Neuroanat. 42, 157-183 (2011).
- DeFalco, J., et al. Virus-assisted mapping of neural inputs to a feeding center in the hypothalamus. Science. 291, 2608-2613 (2001).
- Kumar, D., et al. Murine arcuate nucleus kisspeptin neurons communicate with GnRH neurons in utero. J. Neurosci. 34, 3756-3766 (2014).
- Horowitz, L. F., Montmayeur, J. P., Echelard, Y., Buck, L. B. A genetic approach to trace neural circuits. Proc. Natl. Acad. Sci. U.S.A. 96, 3194-3199 (1999).
- Maskos, U., Kissa, K., ST Cloment, C., Brulet, P. Retrograde trans-synaptic transfer of green fluorescent protein allows the genetic mapping of neuronal circuits in transgenic mice. Proc. Natl. Acad. Sci. U.S.A. 99, 10120-10125 (2002).
- De Roux, N., et al. Hypogonadotropic hypogonadism due to loss of function of the KiSS1-derived peptide receptor GPR54. Proc. Natl. Acad. Sci. U.S.A. 100, 10972-10976 (2003).
- Seminara, S. B., et al. The GPR54 gene as a regulator of puberty. N. Engl. J. Med. 349, 1614-1627 (2003).
- Mayer, C., et al. Timing and completion of puberty in female mice depend on estrogen receptor alpha-signaling in kisspeptin neurons. Proc. Natl. Acad. Sci. U.S.A. 107, 22693-22698 (2010).
- Soriano, P. Generalized lacZ expression with the ROSA26 Cre reporter strain. Nat. Genet. 21, 70-71 (1999).
- Seibler, J., et al. Single copy shRNA configuration for ubiquitous gene knockdown in mice. Nucleic Acids Res. 33, e67 (2005).
- Semaan, S. J., Kauffman, A. S. Emerging concepts on the epigenetic and transcriptional regulation of the Kiss1 gene. Int. J. Dev. Neurosci. 31, 452-462 (2013).
- Feil, R., et al. Ligand-activated site-specific recombination in mice. Proc. Natl. Acad. Sci. U.S.A. 93, 10887-10890 (1996).
