شرطي عبر التشابك الوراثية للبحث عن المفقودين في المخ الجنينية الماوس
Summary
Capitalizing on a binary genetic strategy we provide a detailed protocol for neural circuit tracing in mice that express complementary transsynaptic tracers after Cre-mediated recombination. Because cell-specific tracer production is genetically encoded, our experimental approach is suitable to study the formation and maturation of neural circuitry during murine embryonic brain development at a single cell resolution.
Abstract
Anatomical path tracing is of pivotal importance to decipher the relationship between brain and behavior. Unraveling the formation of neural circuits during embryonic maturation of the brain however is technically challenging because most transsynaptic tracing methods developed to date depend on stereotaxic tracer injection. To overcome this problem, we developed a binary genetic strategy for conditional genetic transsynaptic tracing in the mouse brain. Towards this end we generated two complementary knock-in mouse strains to selectively express the bidirectional transsynaptic tracer barley lectin (BL) and the retrograde transsynaptic tracer Tetanus Toxin fragment C from the ROSA26 locus after Cre-mediated recombination. Cell-specific tracer production in these mice is genetically encoded and does not depend on mechanical tracer injection. Therefore our experimental approach is suitable to study neural circuit formation in the embryonic murine brain. Furthermore, because tracer transfer across synapses depends on synaptic activity, these mouse strains can be used to analyze the communication between genetically defined neuronal populations during brain development at a single cell resolution. Here we provide a detailed protocol for transsynaptic tracing in mouse embryos using the novel recombinant ROSA26 alleles. We have utilized this experimental technique in order to delineate the neural circuitry underlying maturation of the reproductive axis in the developing female mouse brain.
Introduction
تتبع مسار التشريحية هي واحدة من الأدوات المستخدمة الأكثر شيوعا فك العلاقة بين الدماغ والسلوك 1. التقدم في تقنيات تتبع الدائرة العصبية أسبغها علماء الأعصاب لديهم القدرة على تتبع الدوائر العصبية من الخلايا العصبية التي تم تحديدها السكان وراثيا في الفئران 2. وعلى الرغم من هذه التطورات التقنية التي لا يزال تحديا لكشف تشكيل الدوائر العصبية وخاصة أثناء نضوج الجنينية. وذلك لأن معظم طرق تتبع ضعت حتى الآن تعتمد على حقن التجسيمي من استشفاف عبر التشابك أو الفيروسات موجه للعصب المعدلة وراثيا (الشكل 1) 2،3. في حين أن هذه التقنيات في تحقيق قرار المكاني والزماني للاتصال، العديد من القيود المتأصلة مثل الحقن تحديا تقنيا التتبع في الدماغ النامية، استنساخ موقع الحقن، والتهاب محتمل في موقع الحقن والأكثر المجمدةسمية الخلايا tantly التي تسببها الفيروسات موجه للعصب تحد من استخدامها 4.
طريقة بديلة هو للتعبير عن استشفاف عبر التشابك كما الجينات المحورة في الفئران المعدلة وراثيا. لقد تم تعديلها مؤخرا هذه التقنية، ووضع عبر التشابك الجيني النظام الثنائي تتبع لرسم خريطة الدوائر العصبية من الخلايا العصبية التي تم تحديدها أية مجموعة من السكان وراثيا 5. ويستند لدينا استراتيجية تجريبية على اثنين من سلالات جديدة الضربة القاضية في الماوس والتي تعبر إما كتين ثنائي الاتجاه التتبع الشعير (BL) 6 أو التتبع الوراء الكزاز السمية جزء C تنصهر إلى GFP (GTT) 7 من موضع ROSA 26 بعد بوساطة لجنة المساواة العرقية- إعادة التركيب. نحن هنا تستخدم هذه السلالات الماوس للتعبير عن انتقائي BL وGTT في الخلايا العصبية التي تنتج kisspeptin، وهو نيوروببتيد الذي تورط في تنظيم نضوج محور الإنجاب 8،9. علينا أن نظهر أن هذه التقنية هي مناسبة لتصور تنمية ونضوج قبلةالدوائر العصبية peptin أثناء التطور الجنيني للدماغ الفأر الإناث 5.
استراتيجية تربية
وR26-BL-IRES-τlacZ (BIZ) وR26-GFP-TTC (GTT) خطوط التتبع هي الضربة القاضية في سلالات 5 التي تحمل أليل ROSA26 المؤتلف. وR26-BIZ والأليلات R26-GTT صامتون transcriptionally بسبب وجود إشارة توقف النسخي قوية، والتي يحيط بها موقعين loxP 5. يتم تنشيط تعبير عن BIZ وGTT التحوير عن طريق إزالة لجنة المساواة العرقية بوساطة إشارة توقف النسخي. الأليلات R26-R26-BIZ وGTT يمكن استخدامها بشكل مستقل من قبل ببساطة الحدودي مع خط سائق لجنة المساواة العرقية. يمكن للحيوانات تحليل متخالف لجنة المساواة العرقية وR26 الأليلات منها استخدامها. تتزاحم تحمل لجنة المساواة العرقية واحد أو واحدة R26 أليل، على التوالي، وينبغي أن تستخدم والضوابط. بدلا من ذلك، فمن الممكن أيضا لتوليد رriple الضربة القاضية في الحيوانات التي تحمل لجنة المساواة العرقية، R26-R26-BIZ وGTT الأليلات، ولكن هذا سيتطلب واحد عبر إضافية.
Protocol
Representative Results
Discussion
معربا عن استشفاف عبر التشابك كما الجينات المحورة لتتبع الدوائر العصبية من السكان العصبية محددة وراثيا ديها العديد من المزايا مقارنة مع الحقن التجسيمي من استشفاف أو الفيروسات neurotopic. أولا، يتم إنتاج التتبع باعتبارها بروتين الذاتية، وبالتالي لا تثير أي رد فعل مناعي و?…
Disclosures
The authors have nothing to disclose.
Acknowledgements
We thank Michael Candlish for critical comments on the manuscript. This project was supported by the Deutsche Forschungsgemeinschaft grants BO1743/6 and SFB/TRR 152 P11 and Z02 to Ulrich Boehm.
Materials
| Name of Material/ Equipment | Company | Catalog Number | Comments/Description |
| Bisbenzimide (Hoechst 33258 dye) | Sigma | 14530-100MG | |
| Ethanol | Sigma | 32205-1L | |
| Cryo mold (Peel-a-way) | Polyscience Inc. | 18646A-1 | 22mm x 22mm x 20mm |
| DMSO | Sigma | D8418-100ML | |
| Dimethyl Formamide (DMF) | VWR Chemicals | 23470,293 | |
| EGTA | ROTH | 3054.3 | |
| Fluoromount G | Southern Biotech | 0100-01 | |
| Glutaraldehyde | Sigma | G5882-50ML | |
| Hydrogen peroxide | Sigma | 34988-7 | |
| Isopentane (Methyl 2-butane) | Sigma | M32631-2.5L | |
| Kaiser's Glycine gelatin | Merck | 1092420100 | |
| Methanol | Sigma | 494437-1L | |
| MgCl2 | Sigma | M2670-100G | |
| NaCl | ROTH | HN00.2 | |
| NBT | Sigma | 298-83-9 | |
| Nonidet P40 substitute | Fluka | 743.85 | |
| OCT | Leica | 14020108926 | |
| PAP pen | Dako | S2002 | |
| Parafarmaldehyde | Sigma | P6148-1KG | |
| Sodium deoxycholate | Sigma | D6750-25G | |
| Sucrose | Sigma | S7903-1KG | |
| Superfrost slides | Thermo Scientific | FT4981GLPLUS | |
| TSA kit | PerkinElmer | NEL700 | |
| TSA plus kit | PerkinElmer | NEL749A001KT | |
| Tris | ROTH | AE15.2 | |
| Triton-X 100 | ROTH | 3051.2 | |
| Tween 20 | ROTH | 9127.1 | |
| X-gal | ROTH | 2315.1 | |
| Cryostat | Leica | na | |
| Light microscope equipped with DIC imaging | Zeiss | Axioskop2 equipped with Axio Vision software | |
| Fluroscence microscope | Zeiss | Axioskop2 equipped with Axio Vision software | |
| Photoshop | Adobe | PS6 | |
| Goat anti-WGA (recognizes BL) | Vector Laboatories | AS-2024 | |
| Biotinylayted horse anti-goat IgG | Vector Laboatories | BA-9500 | |
| Biotinylated goat anti-rabbit IgG | Vector Laboatories | BA-1000 | |
| Rabbit anti-GFP (recognizes GTT) | Invitrogen | A11122 | |
| Rabbit anti-GnRH | Affinity Bio Reagent | PA1-121 | |
| Dylight488-donkey anti-rabbit IgG | Thermo Scientific | SA5-10038 | |
| SA-Alexa Fluor 546 | Life Technologies | S-11225 | |
| Primers | |||
| BL Fwd (for BIZ genotyping) | Eurofins MWG Operon | ATGAAGATGATGAGCACCAG GGC |
|
| BL Rev (for BIZ genotyping) | Eurofins MWG Operon | AGCCCTCGCCGCAGAACTC | |
| Cre Fwd (for Cre genotyping) | Eurofins MWG Operon | GTCGATGCAACGAGTGATGAG GTTCG |
|
| Cre Rev (for Cre genotyping) | Eurofins MWG Operon | CCAGGCTAAGTGCCTTCTCTAC ACCTGC |
|
| TTC Fwd (for GTT genotyping) | Eurofins MWG Operon | AGCAAGGGCGAGGAGCTGTT | |
| TTC Rev (for GTT genotyping) | Eurofins MWG Operon | GTCTTGTAGTTGCCGTCGTCCT TGAA |
|
| XY Fwd (for gender genotyping) | Eurofins MWG Operon | TGAAGCTTTTGGCTTTGA | |
| XY Rev (for gender genotyping) | Eurofins MWG Operon | CCGCTGCCAAATTCTTTG | |
| ROSA26 Fwd | Eurofins MWG Operon | CGAAGTCGCTCTGAGTTGTTATC | |
| ROSA26 Rev | Eurofins MWG Operon | GCAGATGGAGCGGGAGAAAT | |
| SA Rev | Eurofins MWG Operon | CGAAGTCGCTCTGAGTTGTTATC | |
References
- Vercelli, A., Repici, M., Garbossa, D., Grimaldi, A. Recent techniques for tracing pathways in the central nervous system of developing and adult mammals. Brain. Res. Bull. 51, 11-28 (2000).
- Huang, Z. J., Zeng, H. Genetic approaches to neural circuits in the mouse. Annu. Rev. Neurosci. 36, 183-215 (2013).
- Lanciego, J. L., Wouterlood, F. G. A half century of experimental neuroanatomical tracing. J. Chem. Neuroanat. 42, 157-183 (2011).
- DeFalco, J., et al. Virus-assisted mapping of neural inputs to a feeding center in the hypothalamus. Science. 291, 2608-2613 (2001).
- Kumar, D., et al. Murine arcuate nucleus kisspeptin neurons communicate with GnRH neurons in utero. J. Neurosci. 34, 3756-3766 (2014).
- Horowitz, L. F., Montmayeur, J. P., Echelard, Y., Buck, L. B. A genetic approach to trace neural circuits. Proc. Natl. Acad. Sci. U.S.A. 96, 3194-3199 (1999).
- Maskos, U., Kissa, K., ST Cloment, C., Brulet, P. Retrograde trans-synaptic transfer of green fluorescent protein allows the genetic mapping of neuronal circuits in transgenic mice. Proc. Natl. Acad. Sci. U.S.A. 99, 10120-10125 (2002).
- De Roux, N., et al. Hypogonadotropic hypogonadism due to loss of function of the KiSS1-derived peptide receptor GPR54. Proc. Natl. Acad. Sci. U.S.A. 100, 10972-10976 (2003).
- Seminara, S. B., et al. The GPR54 gene as a regulator of puberty. N. Engl. J. Med. 349, 1614-1627 (2003).
- Mayer, C., et al. Timing and completion of puberty in female mice depend on estrogen receptor alpha-signaling in kisspeptin neurons. Proc. Natl. Acad. Sci. U.S.A. 107, 22693-22698 (2010).
- Soriano, P. Generalized lacZ expression with the ROSA26 Cre reporter strain. Nat. Genet. 21, 70-71 (1999).
- Seibler, J., et al. Single copy shRNA configuration for ubiquitous gene knockdown in mice. Nucleic Acids Res. 33, e67 (2005).
- Semaan, S. J., Kauffman, A. S. Emerging concepts on the epigenetic and transcriptional regulation of the Kiss1 gene. Int. J. Dev. Neurosci. 31, 452-462 (2013).
- Feil, R., et al. Ligand-activated site-specific recombination in mice. Proc. Natl. Acad. Sci. U.S.A. 93, 10887-10890 (1996).
