Source: Herb, M. et al., Highly Efficient Transfection of Primary Macrophages with In Vitro Transcribed mRNA. J. Vis. Exp. (2019)
This video demonstrates the process of transfecting primary macrophages with modified mRNA encoding green fluorescent protein. These modified mRNAs, designed to reduce immunogenicity and improve its stability, ensure the successful transfection and subsequent expression of green fluorescent proteins, which is confirmed through fluorescence microscopy.
All procedures involving animal models have been reviewed by the local institutional animal care committee and the JoVE veterinary review board.
NOTE: Carry out all steps wearing gloves. Carry out all transfection steps under a laminar flow hood to prevent contamination of the cells. Before working with mRNA, clean all instruments such as pipettes and every surface with 70% ethanol and/or an RNAse-degrading surfactant (Table of Materials). Ensure that all reaction tubes are RNAse-free and sterile. Use only sterile, RNAase-free water for dilutions. Exclusively use pipette tips with filters. Change pipette tips after every pipetting step.
1. Generation of the DNA Template
NOTE: The DNA template for in vitro mRNA transcription using this protocol must contain a T7 promotor sequence to allow docking of the RNA polymerase. If the plasmid containing the DNA sequence of the protein of interest already contains a correctly orientated T7 promotor sequence directly upstream of the sequence of interest, linearization of the plasmid (see step 1.1.) needs to be performed. Otherwise, attach a T7 promotor to the sequence of interest by polymerase chain reaction (PCR, see step 1.2.).
2. mRNA Generation
3. mRNA Purification
4. Macrophage Preparation
5. Transfection of Macrophages with mRNA
The authors have nothing to disclose.
5-methyl-CTP (100 mM) | Jena Biosience | NU-1138S | stored at -20 °C |
Antarctic phosphatase | New England BioLabs | M0289 | stored at -20 °C |
Antarctic phosphatase reaction buffer (10X) | New England BioLabs | B0289 | stored at -20 °C |
anti-NEMO/IKKγ antibody | Invitrogen | MA1-41046 | stored at -20 °C |
anti-β-actin antibody | Sigma-Aldrich | A2228 | stored at -20 °C |
Petri dishes 92,16 mm with cams | Sarstedt | 8,21,473 | stored at RT |
CD11b Microbeads mouse and human | Miltenyi Biotec | 130-049-601 | stored at 4 °C |
Cre recombinase + T7-Promotor forward primer | Sigma-Aldrich | 5′-GAAATTAATACGACTCACTATA GGGGCAGCCGCCACCATGTCC AATTTACTGACCGTAC-3', stored at -20 °C |
|
Cre recombinase + T7-Promotor reverse primer | Sigma-Aldrich | 5′-CTAATCGCCATCTTCCAGCAGG C-3′, stored at -20 °C |
|
DNA purification kit: QIAquick PCR purification Kit | Qiagen | 28104 | stored at RT |
eGFP + T7-Promotor forward primer | Sigma-Aldrich | 5´-GAAATTAATACGACTCACTATA GGGATCCATCGCCACCATGGTG AGCAAGG-3´, stored at -20 °C |
|
eGFP + T7-Promotor reverse primer | Sigma-Aldrich | 5´-TGGTATGGCTGATTA TGATCTAGAGTCG-3´, stored at -20 °C |
|
Fast Digest buffer (10X) | Thermo Scientific | B64 | stored at -20 °C |
FastDigest XbaI | Thermo Scientific | FD0684 | stored at -20 °C |
High-fidelity polymerase with proofreading: Q5 High-Fidelity DNA-Polymerase | New England Biolabs Inc | M0491S | stored at -20 °C |
IKKβ + T7-Promotor forward primer | Sigma-Aldrich | 5′-GAAATTAATACGACTCACTATA GGGTTGATCTACCATGGACTACA AAGACG-3′, stored at -20 °C |
|
IKKβ + T7-Promotor reverse primer | Sigma-Aldrich | 5′-GAGGAAGCGAGAGCT-CCATCTG-3′, stored at -20 °C | |
in vitro mRNA transcription kit: HiScribe T7 ARCA mRNA kit (with polyA tailing) | New England BioLabs | E2060 | stored at -20 °C |
LS Columns | Miltenyi Biotec | 130-042-401 | stored at RT |
MACS MultiStand | Miltenyi Biotec | 130-042-303 | stored at RT |
mRNA transfection buffer and reagent: jetMESSENGER | Polyplus transfection | 409-0001DE | stored at 4 °C |
Mutant IKKβ IKK-2S177/181E plasmid | Addgene | 11105 | stored at -20 °C |
Mutant NEMOC54/347A plasmid | Addgene | 27268 | stored at -20 °C |
pEGFP-N3 plasmid | Addgene | 62043 | stored at -20 °C |
Poly(I:C) | Calbiochem | 528906 | stored at -20 °C |
pPGK-Cre plasmid | F. T. Wunderlich, H. Wildner, K. Rajewsky, F. Edenhofer, New variants of inducible Cre recombinase: A novel mutant of Cre-PR fusion protein exhibits enhanced sensitivity and an expanded range of inducibility. Nucleic Acids Res. 29, 47e (2001). stored at -20 °C | ||
Pseudo-UTP (100 mM) | Jena Biosience | NU-1139S | stored at -20 °C |
QuadroMACS Separator | Miltenyi Biotec | 130-090-976 | stored at RT |
Rat-anti-mouse CD11b antibody, APC-conjugated | BioLegend | 101212 | stored at 4 °C |
Rat-anti-mouse F4/80 antibody, PE-conjugated | eBioscience | 12-4801-82 | stored at 4 °C |
recombinant M-CSF | Peprotech | 315-02 | stored at -20 °C |
RNA purification kit: MEGAclear transcription clean-up kit | ThermoFisher Scientific | AM1908 | stored at 4 °C |
RNAse-degrading surfactant: RnaseZAP | Sigma-Aldrich | R2020 | stored at RT |
Ultrapure LPS from E.coli O111:B4 | Invivogen | stored at -20 °C | |
Wild type IKKβ plasmid | Addgene | 11103 | stored at -20 °C |
Wild type NEMO plasmid | Addgene | 27268 | stored at -20 °C |