Inductie van mesenchymale-epitheliale Transities sarcoomcellen
Özet
We presenteren hier een celkweek werkwijze voor het induceren mesenchymale-epitheliale overgangen (MET) sarcoom cellen op basis van gecombineerde ectopische expressie van microRNA-200 familieleden en grainyhead-achtig 2 (GRHL2). Deze methode is geschikt voor een beter begrip van de biologische gevolgen van de fenotypische plasticiteit in de agressiviteit van kanker en behandelingen.
Abstract
Fenotypische plasticiteit verwijst naar een fenomeen waarin cellen transiënt trekken van een lijn krijgen. Tijdens carcinoom progressie, fenotypische plasticiteit drijft invasie, verspreiding en metastase. Inderdaad, terwijl de meeste van de studies van fenotypische plasticiteit in het kader van epitheliale carcinomen afkomstig zijn, blijkt sarcomen, die mesenchymale oorsprong zijn, ook fenotypische plasticiteit vertonen, met een subset van sarcomen een verschijnsel dat lijkt mesenchymal- ondergaan epitheliale transitie (MET). Hier hebben we een werkwijze omvattende de miR-200-familie en grainyhead als 2 (GRHL2) deze MET-achtige fenomeen waargenomen sarcoom patiënten samples.We achtereenvolgens tot expressie GRHL2 en miR-200 familie die cel transductie en transfectie nabootsen respectievelijk , beter inzicht in de moleculaire onderbouwing van deze fenotypische overgangen in sarcoma cellen. Sarcoma cellen die miR-200s en GRHL2 aangetoond verbeterde epitheliale characteristics in cel morfologie en verandering van epitheliale en mesenchymale biomarkers. Toekomstige studies met behulp van deze methoden kunnen worden gebruikt om beter inzicht in de fenotypische gevolgen van de MET-achtige processen op sarcoma cellen, zoals migratie, invasie, metastatische neiging, en therapie weerstand.
Introduction
Fenotypische plasticiteit heeft betrekking op een reversibele overgang tussen cellulaire fenotypes en wordt gewoonlijk verdeeld in twee types, epitheliale naar mesenchymale (EMT) overgangen en mesenchymale tot epitheliale overgangen (MET). Deze fenotypische plasticiteit speelt een belangrijke rol in de normale processen van meercellige organismen, zoals de ontwikkeling en wondgenezing 1; echter kan deze zelfde paden en genexpressie programma ook leiden tot ziekten zoals fibrose (samengevat in 2, 3, 4) en carcinoom metastase (samengevat in referenties 5, 6, 7, 8). Tijdens metastase, bijvoorbeeld EMT verstoort celpolariteit, cel-cel interacties en bevordert invasie 9, 10. Samen EMT bijdragens om een fenotypische staat die kankercel verspreiding vergemakkelijkt. Bovendien, EMT leidt ook tot een aantal andere fenotypische veranderingen die een agressieve fenotype trekken, inclusief deregulering van kankercel metabolisme 6, ontwikkeling van geneesmiddelresistentie 11, 12, verhoogde tumor-initiatie vermogen 13, 14 en gastheer immuunontwijking 15.
Fenotypische plasticiteit is goed onderzocht in carcinoom progressie; Maar ook sarcomen fenotypische plasticiteit vertonen. Interessant, lijkt het alsof een aantal van dezelfde drijfveren van fenotypische plasticiteit in carcinomen ook bijdragen aan sarcoom plasticiteit en agressiviteit. Zo zijn circulerende tumorcellen (CTCs) vanaf sarcoom patiënten aangetoond dat EpCAM, een celoppervlakte-eiwit dat gewoonlijk wordt gevonden op epitheelcellen 16 expressie brengen. Additioneel werd 250 wekedelensarcoom monsters geclassificeerd als epitheel-achtige of mesenchymale-achtige basis van genexpressie. Patiënten in de epitheliale-achtige biomarker handtekening had een betere prognose dan patiënten met de mesenchymale-achtige biomarker handtekening 17. Dit is consistent met vele carcinomen, waarbij patiënten met meer epitheel-achtige carcinomen hebben betere resultaten in vergelijking met patiënten met meer mesenchymale-achtige tumoren 18.
Terwijl sommige sarcomen geven biomerkers en genexpressie paden in overeenstemming met BMO blijven de moleculaire onderbouwing van deze fenotypische plasticiteit slecht begrepen. Om de mechanismen en bestuurders van BMO in sarcoma bestuderen we een model ontwikkeld van BMO inductie met behulp van twee epitheliale-specifieke factoren, de microRNA (MIR) -200 familie en grainyhead-achtige 2 (GRHL2). De miR-200S zijn een familie van kleine niet-coderende RNAs die genexpressie reguleren door te binden aan de 3' UTR van messenger RNA en verhinderen translatie in eiwit. Het miR-200 familie bestaat uit twee subgroepen – een met miR-141 en miR-200a en de andere met inbegrip van miR-200b, miR-200c en miR-429. Familieleden miR-200 verrijkt in epitheliale weefsels, en het verlies van miR-200s is geassocieerd met metastase in carcinomen 19. De familie miR-200 ook omlaag gereguleerd in zacht weefsel sarcomen in vergelijking met normaal weefsel 20. Net als bij de miR-200S, GRHL2 is een belangrijke regulator die belangrijk is voor epitheliale ontwikkeling 21. De GRHL2 transcriptiefactor fungeert op twee manieren epitheliale genen, zoals E-cadherine upregulate: 1) in epitheelcellen, GRHL2 direct onderdrukt de EMT hoofdregelaar, ZEB1 22; en 2) GRHL2 direct activeert transcriptie van genen epitheliale 23. Onze eerdere onderzoekingen hebben aangetoond dat de gecombineerde expressie van miR-200s en GRHL2 in sarcoomcelleninduceert een MET-fenotype 24. Hier presenteren we een gedetailleerd protocol voor een in vitro model van MET inductie in sarcoomcellen via ectopische expressie van miR-200s en GRHL2 creëren.
Protocol
Representative Results
Discussion
Sarcomen zijn zeldzaam, maar zeer agressieve kanker van een mesenchymale lijn. Ondanks hun mesenchymale lijn, een subset van sarcomen blijkt een fenotypische overgang naar een epitheel-achtige toestand ondergaan. Dit MET-achtige schakelaar prognostische impact, zoals patiënten met epitheel-achtige tumoren zijn minder agressief 24. Ondanks hun klinische relevantie, zijn er weinig studies over de moleculaire mechanismen die deze fenotypische overgangen in sarcomen.
Om …
Açıklamalar
The authors have nothing to disclose.
Acknowledgements
JAS erkent steun van het Duke Cancer Institute, The Duke University Genitourinary Oncology Laboratory, en de Duke University Afdeling Orthopedie. HL werd gesteund door de National Science Foundation (NSF) Centrum voor Theoretische Biological Physics (NSF PHY-1.427.654) en NSF DMS-1.361.411, en als een CPRIT (Cancer Prevention and Research Institute of Texas) Scholar in Cancer Research van de staat Texas aan de Rice University. KEW werd ondersteund door NIH F32 CA192630 MKJ en HL geprofiteerd van nuttige besprekingen met Mary C. Farach-Carson, JN Onuchic, Samir M. Hanash, Kenneth J. Pienta en Donald S. Coffey.
Materials
| Countess automated counter | Life technologies | AMQAX1000 | |
| Countess cell counting chamber slides | Invitrogen | C10283 | |
| SimpliAmp Thermal Cycler | Thermo Fisher | A24811 | |
| Odyssey Fc | LI-COR Inc | ||
| ViiA7 Real Time PCR System | Thermo Fisher | 4453536 | |
| PCR microplate | Corning | 321-29-051 | |
| KAPA SYBR Fast Universal qPCR Kit | KAPA Biosystems | KK4602 | |
| Starting Block (PBS) Blocking Buffer | Thermo Fisher | 37538 | BSA-based blocking buffer |
| Agarose General Purpose LE | Genesee Scientific | 20-102 | |
| 10X Tris/Glycine/SDS Buffer | Bio-Rad Laboratories Inc | 161-0732 | Running buffer |
| 10X Tris/Glycine Buffer | Bio-Rad Laboratories Inc | 161-0734 | Transfer buffer |
| RIPA Buffer | Sigma Life Sciences | SLBG8489 | |
| Amersham Protran 0.45 μm nitrocellulose | GE Healthcare Lifesciences | 10600012 | |
| Quick-RNA MiniPrep Kit | Genesee Scientific | 11-358 | |
| Laemmli Sample Buffer (4X) | Bio-Rad Laboratories Inc | 1610747 | |
| Mini Trans-Blot Cell | Bio-Rad Laboratories Inc | 1703930 | |
| Mini-Protean Tetra Cell | Bio-Rad Laboratories Inc | 1658005EDU | |
| DPBS | Life technologies | 14190-144 | |
| 0.05% Trypsin-EDTA | Life technologies | 11995-065 | |
| DMEM | Life technologies | 11995-065 | |
| Lipofectamine RNAi Max | Thermo Fisher | 13778150 | |
| Lipofectamine 2000 Ragents | Thermo Fisher | 11668019 | |
| Penicillin Streptomycin | Life technologies | 15140-122 | |
| miRVana miRNA mimic negative control #1 | Thermo Fisher | 4464058 | neg miRNA |
| hsa-miR-200 mirVana miRNA mimic | Thermo Fisher | 4464066 | miR200A |
| has-miR-200 mirVana miRNA mimic | Thermo Fisher | 4404066 | miR200B |
| has-miR-200 mirVana miRNA mimic | Thermo Fisher | 4404066 | miR200C |
| Opti-MEM | Life technologies | 11088-021 | serum-free media |
| anti-Ecadherin antibody | BD Bioscience | 610182 | |
| anti-beta actin | Santa Cruz Biotechnology | sc-69879 | |
| anti-EpCam | Ab Serotec | MCA18706 | |
| anti-ZO1 | Invitrogen | 402200 | |
| IRDye 800W | LI-COR Inc | 925-32210 | |
| IRDye 680 | LI-COR Inc | 926-32223 | |
| anti-mouse AlexaFluor 647 | Thermo Fisher | A211241 | |
| anti-rabbit AlexaFluor 647 | Thermo Fisher | ab150075 | |
| Halt Protease and Phosphatesse Inhibitor | Thermo Fisher | 1861281 | |
| Precision Plus Protein Dual Color | Bio-Rad Laboratories Inc | 161-0374 | |
| Partec CellTrics | Sysmex | 04-004-2326 | 30 μm filter for flow |
| GAPDH-F | IDT | AGCCACATCGCTCAGACAC | |
| GAPDH-R | IDT | GCCCAATACGACCAAATCC | |
| Ecadherin-F | IDT | TGGAGGAATTCTTGCTTTGC | |
| Ecadherin-R | IDT | CGCTCTCCTCCGAAGAAAC | |
| ZEB1-F | IDT | GCATACAGAACCCAACTTGAACGTC | |
| ZEB1-R | IDT | CGATTACACCCAGACTGC | |
| NOTCH-F | IDT | GGCAATCCGAGGACTATGAG | |
| NOTCH-R | IDT | CTCAGAACGCACTCGTTGAT | |
| nitro blue tetrazolium | Sigma | N5514 | |
| hexadimethrine bromide | Sigma | H9268 | polybrene |
| 3 mL syringe | BD Bioscience | 309657 | |
| Sterile syringe filter | VWR | 28145-505 | |
| 5mL polypropylene round-bottom tube | 352063 | flow cytometry tubes | |
| High-Capacity cDNA Reverse Transcription Kit | Thermo Fisher | 4368814 | reverse transcription kit |
| 4% paraformaldyhyde | Santa Cruz Biotechnology | sc-281612 | |
| Triton-X100 | Sigma | 93443 | |
| bovine serum albumin | Sigma | A7906 |
Referanslar
- Weber, C. E., Li, N. Y., Wai, P. Y., Kuo, P. C. Epithelial-mesenchymal transition, TGF-beta, and osteopontin in wound healing and tissue remodeling after injury. J Burn Care Res. 33 (3), 311-318 (2012).
- Galichon, P., Finianos, S., Hertig, A. EMT-MET in renal disease: should we curb our enthusiasm. Cancer Lett. 341 (1), 24-29 (2013).
- Carew, R. M., Wang, B., Kantharidis, P. The role of EMT in renal fibrosis. Cell Tissue Res. 347 (1), 103-116 (2012).
- Willis, B. C., Borok, Z. TGF-beta-induced EMT: mechanisms and implications for fibrotic lung disease. Am J Physiol Lung Cell Mol Physiol. 293 (3), L525-L534 (2007).
- Ye, X., Weinberg, R. A. Epithelial-Mesenchymal Plasticity: A Central Regulator of Cancer Progression. Trends Cell Biol. 25 (11), 675-686 (2015).
- Li, L., Li, W. Epithelial-mesenchymal transition in human cancer: comprehensive reprogramming of metabolism, epigenetics, and differentiation. Pharmacol Ther. 150, 33-46 (2015).
- Tsai, J. H., Yang, J. Epithelial-mesenchymal plasticity in carcinoma metastasis. Genes Dev. 27 (20), 2192-2206 (2013).
- Bitting, R. L., Schaeffer, D., Somarelli, J. A., Garcia-Blanco, M. A., Armstrong, A. J. The role of epithelial plasticity in prostate cancer dissemination and treatment resistance. Cancer Metastasis Rev. 33 (2-3), 441-468 (2014).
- Schaeffer, D., Somarelli, J. A., Hanna, G., Palmer, G. M., Garcia-Blanco, M. A. Cellular Migration and Invasion Uncoupled: Increased Migration Is Not an Inexorable Consequence of Epithelial-to-Mesenchymal Transition. Mol Cell Biol. 34 (18), 3486-3499 (2014).
- Mathow, D., et al. Zeb1 affects epithelial cell adhesion by diverting glycosphingolipid metabolism. EMBO Rep. 16 (3), 321-331 (2015).
- Ware, K. E., et al. A mechanism of resistance to gefitinib mediated by cellular reprogramming and the acquisition of an FGF2-FGFR1 autocrine growth loop. Oncogenesis. 2, e39 (2013).
- Yauch, R. L., et al. Epithelial versus mesenchymal phenotype determines in vitro sensitivity and predicts clinical activity of erlotinib in lung cancer patients. Clin Cancer Res. 11 (24 Pt 1), 8686-8698 (2005).
- Jolly, M. K., et al. Towards elucidating the connection between epithelial-mesenchymal transitions and stemness. J R Soc Interface. 11 (101), 20140962 (2014).
- Mani, S. A., et al. The epithelial-mesenchymal transition generates cells with properties of stem cells. Cell. 133 (4), 704-715 (2008).
- Chen, L., et al. Metastasis is regulated via microRNA-200/ZEB1 axis control of tumour cell PD-L1 expression and intratumoral immunosuppression. Nat Commun. 5, 5241 (2014).
- Nicolazzo, C., Gradilone, A. Significance of circulating tumor cells in soft tissue sarcoma. Anal Cell Pathol (Amst). , 697395 (2015).
- Somarelli, J. A., et al. Mesenchymal-epithelial transition in sarcomas is controlled by the combinatorial expression of miR-200s and GRHL2. Mol Cell Biol. , (2016).
- Bae, Y. K., Choi, J. E., Kang, S. H., Lee, S. J. Epithelial-Mesenchymal Transition Phenotype Is Associated with Clinicopathological Factors That Indicate Aggressive Biological Behavior and Poor Clinical Outcomes in Invasive Breast Cancer. J Breast Cancer. 18 (3), 256-263 (2015).
- Humphries, B., Yang, C. The microRNA-200 family: small molecules with novel roles in cancer development, progression and therapy. Oncotarget. 6 (9), 6472-6498 (2015).
- Renner, M., et al. MicroRNA profiling of primary high-grade soft tissue sarcomas. Genes Chromosomes Cancer. 51 (11), 982-996 (2012).
- Petrof, G., et al. Mutations in GRHL2 result in an autosomal-recessive ectodermal Dysplasia syndrome. Am J Hum Genet. 95 (3), 308-314 (2014).
- Werner, S., et al. Dual roles of the transcription factor grainyhead-like 2 (GRHL2) in breast cancer. J Biol Chem. 288 (32), 22993-23008 (2013).
- Werth, M., et al. The transcription factor grainyhead-like 2 regulates the molecular composition of the epithelial apical junctional complex. Development. 137 (22), 3835-3845 (2010).
- Somarelli, J. A., et al. Mesenchymal-Epithelial Transition in Sarcomas Is Controlled by the Combinatorial Expression of MicroRNA 200s and GRHL2. Mol Cell Biol. 36 (19), 2503-2513 (2016).
- Varma, S., et al. The transcription factors Grainyhead-like 2 and NK2-homeobox 1 form a regulatory loop that coordinates lung epithelial cell morphogenesis and differentiation. J Biol Chem. 287 (44), 37282-37295 (2012).
- Pruitt, S. C., Mielnicki, L. M., Stewart, C. C. Analysis of fluorescent protein expressing cells by flow cytometry. Methods Mol Biol. 263, 239-258 (2004).
- Zhao, Z., et al. A high-content morphological screen identifies novel microRNAs that regulate neuroblastoma cell differentiation. Oncotarget. 5 (9), 2499-2512 (2014).
- Borowicz, S., et al. The soft agar colony formation assay. J Vis Exp. (92), e51998 (2014).
- Yang, J., et al. Integrated proteomics and genomics analysis reveals a novel mesenchymal to epithelial reverting transition in leiomyosarcoma through regulation of slug. Mol Cell Proteomics. 9 (11), 2405-2413 (2010).
- Alba-Castellon, L., et al. Snail1 expression is required for sarcomagenesis. Neoplasia. 16 (5), 413-421 (2014).
- Takaishi, M., Tarutani, M., Takeda, J., Sano, S. Mesenchymal to Epithelial Transition Induced by Reprogramming Factors Attenuates the Malignancy of Cancer Cells. PLoS One. 11 (6), e0156904 (2016).
