JoVE Journal > Immunology and Infection
Özet
Abstract
Introduction
Protocol
Sonuçlar
Discussion
Açıklamalar
Acknowledgements
Materials
Referanslar
İmmünoloji ve Enfeksiyon

High-throughput Antiviral Assays to Screen for Inhibitors of Zika Virus Replication

Published: October 30, 2021
doi:
10.3791/62422
, , , , , ,
1São Carlos Institute of Physics,University of Sao Paulo

Özet

In this work, we describe the protocols used in replicon-based and viral enzyme-based assays to screen for inhibitors of Zika virus replication in a high-throughput screening format.

Abstract

Antiviral drug discovery requires the development of reliable biochemical and cellular assays that can be performed in high-throughput screening (HTS) formats. The flavivirus non-structural (NS) proteins are thought to co-translationally assemble on the endoplasmic reticulum (ER) membranes, forming the replication complex (RC). The NS3 and NS5 are the most studied enzymes of the RC and constitute the main targets for drug development due to their crucial roles in viral genome replication. NS3 protease domain, which requires NS2B as its cofactor, is responsible for the cleavage of the immature viral polyprotein into the mature NS proteins, whereas NS5 RdRp domain is responsible for the RNA replication. Herein, we describe in detail the protocols used in replicon-based screenings and enzymatic assays to test large compound libraries for inhibitors of the Zika virus (ZIKV) replication. Replicons are self-replicating subgenomic systems expressed in mammalian cells, in which the viral structural genes are replaced by a reporter gene. The inhibitory effects of compounds on viral RNA replication can be easily evaluated by measuring the reduction in the reporter protein activity. The replicon-based screenings were performed using a BHK-21 ZIKV replicon cell line expressing Renilla luciferase as a reporter gene. To characterize the specific targets of identified compounds, we established in-vitro fluorescence-based assays for recombinantly expressed NS3 protease and NS5 RdRp. The proteolytic activity of the viral protease was measured by using the fluorogenic peptide substrate Bz-nKRR-AMC, while the NS5 RdRp elongation activity was directly detected by the increase of the fluorescent signal of SYBR Green I during RNA elongation, using the synthetic biotinylated self-priming template 3′UTR-U30 (5'-biotin-U30-ACUGGAGAUCGAUCUCCAGU-3').

Introduction

The Zika virus (ZIKV) is an emerging arthropod-borne virus member of the genus Flavivirus, which includes the closely related Dengue virus (DENV), Japanese encephalitis virus (JEV) and Yellow Fever virus (YFV), that pose constant threats to public health1. The 2015-16 ZIKV outbreak in the Americas received global attention following its emergence in Brazil due to the association with severe neurological disorders, such as congenital ZIKV-associated microcephaly in newborns2,3 and Guillain-Barré syndrome in adults4. Although the number of infection cases declined throughout the next two years, autochthonous mosquito-borne transmissions of ZIKV were verified in 87 countries and territories in 2019, therefore, evidencing the potential of the virus to re-emerge as an epidemic5. To date, there are no approved vaccines or effective drugs against ZIKV infection.

Antiviral drug discovery requires the development of reliable cellular and biochemical assays that can be performed in high-throughput screening (HTS) formats. Replicon-based screenings and viral enzyme-based assays are two valuable strategies to test small-molecule compounds for inhibitors of ZIKV1. The flavivirus non-structural (NS) proteins are thought to co-translationally assemble on the endoplasmic reticulum (ER) membranes, forming the replication complex (RC)6. The NS3 and NS5 are the most studied enzymes of the RC and constitute the main targets for drug development due to their crucial roles in viral genome replication. NS3 protease domain, which requires NS2B as its cofactor, is responsible for the cleavage of the immature viral polyprotein into the mature NS proteins, whereas NS5 RdRp domain is responsible for the RNA replication6.

Replicons are self-replicating subgenomic systems expressed in mammalian cells, in which the viral structural genes are replaced by a reporter gene. The inhibitory effects of compounds on viral RNA replication can be easily evaluated by measuring the reduction in the reporter protein activity7. Herein, we describe the protocols used for screening inhibitors of the ZIKV replication in a 96-well plate format. The replicon-based assays were performed using a BHK-21 ZIKV Rluc replicon cell line that we have recently developed8. To characterize the specific targets of identified compounds, we established in vitro fluorescence-based assays for recombinantly expressed NS3 protease using the fluorogenic peptide substrate, Bz-nKRR-AMC, whereas for NS5 RdRp we measured the elongation of the synthetic biotinylated self-priming template 3′UTR-U30 (5'-biotin-U30-ACUGGAGAUCGAUCUCCAGU-3'), using the intercalating dye SYBR Green I.

The ZIKV protease (45-96 residues of NS2B cofactor linked to residues 1-177 of NS3 protease domain by a glycine rich linker [G4SG4]) was obtained, as described for YFV9, while the polymerase (276-898 residues of RdRp domain) was cloned and expressed, as detailed in10. Both enzyme sequences were derived from GenBank ALU33341.1. As primary antiviral screenings, compounds are tested at 10 µM and those showing activities ≥ 80% are then evaluated in a dose-dependent manner, resulting in the effective/inhibition (EC50 or IC50) and the cytotoxic (CC50) concentrations. In the context of representative results, the EC50 and CC50 values of NITD008, a known flaviviruses inhibitor11, from replicon-based screenings are shown. For the enzymatic assays, the IC50 values of two compounds from the MMV/DNDi Pandemic Response Box, a library composed of 400 molecules with antibacterial, antifungal and antiviral activities, are shown. The protocols described in this work could be modified to screen for inhibitors of other related flaviviruses.

Protocol

1. Luciferase activity assay

NOTE: Ensure that all procedures involving cell culture are conducted in certified biosafety hoods (see Table of Materials).

  1. Prepare growth media consisting in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% FBS and 500 µg/mL G418.
  2. Prepare a 10 mM stock solution of tested compounds in 100% DMSO, and then dilute them to 1 mM in 100% DMSO.
  3. Culture ZIKV Rluc replicon cells in growth media in a 75 cm2 culture flask at 37 °C in a CO2-humidified incubator (see Table of Materials) until they reach 70-90% confluency.
  4. Discard the medium. Add 5 mL of trypsin-EDTA to the flask for 5 to 10 min and then centrifuge the cells at 125 x g for 5 min.
  5. Discard the supernatant, resuspend the cells in 5 mL of DMEM 10% FBS and count 10 µL of resuspended cells at a hemocytometer.
  6. Adjust the cells to 2 x 104 cells/well in DMEM 10% FBS and seed 100 µL of cells per well in a 96-well cell culture plate (see Table of Materials).
  7. Incubate the plate for 16 h at 37 °C in a CO2-humidified incubator (see Table of Materials).
  8. Next, discard the medium with a multichannel micropipette and add 100 µL/well of DMEM 2% FBS to the plate.
  9. Add 1 µL of the compounds per well to result in a final concentration of 10 µM 1% DMSO in assay medium. In the first column, add only 1% DMSO as a no inhibition control and NITD008 in the last column, as a positive control (100% inhibition).
  10. Incubate the plate for 48 h at 37 °C in a CO2-humidified incubator (see Table of Materials).
  11. Thaw the Renilla luciferase Assay System kit at room temperature, prepare a 1x Renilla luciferase Lysis Buffer working solution and an appropriate volume of Renilla Luciferase reagent (Assay buffer + substrate; 100 µL per well), according to the manufacturer's instructions.
  12. Discard the supernatant from the cells with a multichannel micropipette and add 25 µL of 1x Renilla luciferase Lysis Buffer per well.
  13. Incubate the plate at room temperature for 15 min and then transfer 20 µL of cell lysates with a multichannel micropipette to a white opaque 96-well plate (see Table of Materials) containing 100 µL/well of Renilla luciferase Assay Reagent.
  14. Read the luminescent signals in a luminometer or in any equipment that has the option to read luminescence (see Table of Materials).
  15. For each plate, calculate the Z-factor value 12, as follows: Z′ = 1 – ((3SD of sample + 3SD of control)/│Mean of sample – Mean of control│); SD – standard deviation. A Z-factor between 0.5 and 1.0 means a good quality assay 12.
  16. To determine the EC50 values of compounds, proceed as described in steps 1.3 to 1.8 and then add the compounds serially diluted to the cells , together with the negative (1% DMSO) and positive (NITD008 at 10 µM) controls. Perform the assay twice in duplicates.
  17. Plot the average values of inhibition rates per compound concentration and use a graph analysis software to perform a sigmoidal fitting and obtain the EC50 values.

2. Cell proliferation-based MTT assay

  1. Proceed as described in item 1 steps 1.1 to 1.8.
  2. Add the compounds initially at 10 µM and the control 1% DMSO to the cells.
  3. Prepare a 5 mg/mL MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide) solution in phosphate buffered saline (PBS – 137 mM NaCl, 2,7 mM KCl, 10 mM Na2HPO4, 1,8 mM KH2PO4; pH 7.4) and vortex until complete solubilization of MTT.
  4. Add the MTT solution to the cells at one tenth of the well volume (10 µL/well).
  5. Incubate the plate at 37 °C in a CO2-humidified incubator (see Table of Materials) for 3-4 h.
  6. Discard the supernatant with a multichannel micropipette and add 100 µL of DMSO (100%) to each well.
  7. Solubilize the formazan crystals by pipetting up and down and then read the absorbance at 570 nm in a spectrophotometer (see Table of Materials).
  8. To determine the CC50 values of compounds, proceed as described in item 1 steps 1.1 to 1.8 and then add the compounds serially diluted to the cells, together the negative (1% DMSO) control. Perform the assay twice in duplicates.
  9. Plot the average values of inhibition rates per compound concentration and use a graph analysis software to perform a sigmoidal fitting and obtain the CC50 values.

3. NS2B-NS3 protease activity assay

  1. Thaw a protein aliquot on ice.
  2. Set the plate reader (see Table of Materials) temperature to 37°C.
  3. Prepare the appropriated amount of protein diluted to 80 nM (5 µL/well). Final protein concentration is 4 nM.
  4. Thaw the appropriate amount of Bz-nKRR-AMC substrate on ice (300 µM stock solution diluted in assay buffer, 10 µL/well).
  5. In a 96-well white plate (see Table of Materials), dispense 84 µL of assay buffer (20 mM Tris pH 8.5, 5% glycerol and 0.01% Triton X-100) in each well.
  6. To make the positive control reaction, to each well of the last column dispense 1 µL of Aprotinin to achieve final concentration of 1 µM (stock solution 100 µM diluted in water)
  7. To make the negative control reaction, to the first column dispense 1 µL of DMSO (final concentration 1%).
  8. To perform the compound screening, dispense 1 µL of each compound to achieve final concentration of 10 µM (1 mM stock concentration) excluding positive and negative control wells.
  9. Dispense 5 µL of the protease solution.
  10. Incubate the plate at 4 °C for 30 minutes.
  11. To start the reaction, dispense 10 µL of Bz-nKRR-AMC stock solution (final concentration of 30 µM).
  12. Set the excitation wavelength to 380 nm and emission to 460 nm and read the fluorescence for 30 min every 1 min in a microplate reader (see Table of Materials). Perform the entire experiment at 37 °C.
  13. Calculate the mean values of the fluorescence for positive and negative control reactions. Set as 100% of protease activity the mean value of fluorescence for negative control reactions subtracted of the mean value of positive control and calculate the percentages of activity for each compound.
  14. For each plate, calculate the Z-factor value, as described in step 1.15.
  15. Proceed with IC50 determination for compounds that exhibited an inhibition rate higher than 80%.
  16. Perform the assay in triplicates as described in steps 3.1-3.13, using a serial dilution of the compound.
  17. Plot the average values of inhibition rates per compound concentration and use a graph analysis software to perform a sigmoidal fitting and obtain the IC50 values.

4. NS5 RdRp elongation assay

NOTE: All materials used in this assay are RNase, DNase and pyrogenase free certified.

  1. Prepare both the assay buffer (50 mM Tris pH 7.0, 2.5 mM MnCl2, 0.01% Triton X-100) and the 200 mM ATP stock solution with 0.1% diethylpyrocarbonate (DEPC) treated water.
  2. Anneal a 5 µL aliquot of 200 µM 3′UTR-U30 (5'-biotin-U30-ACUGGAGAUCGAUCUCCAGU-3') in PCR treated water by incubating it for 5 minutes at 55 °C in a thermocycler.
  3. Thaw the stock solution of NS5 RdRp, 200 mM ATP and x10.000 SYBR Green I on ice.
  4. Dilute the protein to a final concentration of 250 nM in 3 mL of assay buffer.
  5. Prepare substrate solution by diluting the stock solutions of the ATP, 3'UTR-U30 and SYBR Green I in 3 mL of assay buffer to a final concentration of 1 mM, 300 nM and 1X, respectively.
  6. In a 96-well PCR plate (see Table of Materials), add 24.5 µL of diluted protein in columns 1 to 11 of each row. Add the same volume of assay buffer in the remaining wells.
  7. For control and blank reaction, add 0.5 µL of DMSO in columns 1 and 12. Add 0.5 µL of compound diluted in DMSO to a final concentration of 10 µM 1mM stock solution).
  8. Seal the plate with a sealing film and incubate at room temperature for 15 minutes.
  9. Start the reaction by adding 25 µL of substrate solution and seal the plate again.
  10. Incubate at 30 °C in a real-time PCR system (see Table of Materials) and monitor the fluorescence for 1 hour, measuring the fluorescence every 30 s with the FAM filter (Emission:494 nm/Excitation:521 nm).
  11. For each plate, calculate the Z-factor value, as described in step 1.15.
  12. Proceed with IC50 determination for compounds that exhibited an inhibition rate higher than 80%, as described in step 3.15.
  13. Plot the average values of inhibition rates per compound concentration and use a graph analysis software to perform a sigmoidal fitting and obtain the IC50 values.

Representative Results

All the protocols described herein were stablished in 96-well plates and allows the evaluation of 80 compounds per plate in a primary screening of a single concentration, including the negative and positive controls placed at the first and last column of the plates, respectively. The replicon-based screenings are represented in Figure 1, which includes the RNA construct developed to obtain the BHK-21-RepZIKV_IRES-Neo cell line (Figure 1A), the assays schematic representation (Figure 1B) and the dose-response curves of NITD008 (EC50 of 0.28 µM, CC50 > 10 µM) (Figure 1C). The EC50 and CC50 values of hit compounds are determined as the concentrations required to inhibit 50% of the Rluc activity and cause 50% cytotoxicity, respectively. With respect to the luciferase assay, DMSO 1% is used as a no inhibitor control (0% inhibition) and NITD008 is used as a positive control (100% inhibition), as previously described8.

The NS2B-NS3 protease activity is measured by fluorescence monitoring of AMC released due to the proteolytic activity of the protease (Figure 2A). Aprotinin, a protein that acts as trypsin inhibitor and is already described as an inhibitor of flavivirus proteases13,14,15, was used in this assay as an experimental positive control (IC50 of 0.13 ± 0.02 µM, data not shown). Figure 2B illustrates a dose-response inhibition curve of a molecule targeting the protease activity, the compound MMV1634402 (IC50 of 0.36 ± 0.08 µM). The elongation activity of NS5 RdRp is measured in real time by the increase in fluorescence intensity of SYBR Green I when intercalated with the synthesized dsRNA (Figure 2C). The dose-response inhibition curve of a hit molecule targeting ZIKV RdRp, the compound MMV1782220 (IC50 of 1.9 ± 0.8 µM), is showed in Figure 2D. Since nucleoside analog inhibitors, such as NITD008, are not suitable for enzymatic assays, as phosphates needs to be incorporated intracellularly to the molecule16, we did not use any positive control for NS5 RdRp elongation assay. However, Clofazimine, a commercial antibiotic, which we recently identified as an inhibitor of viral polymerase8, could be used as an experimental control in next assays.

Figure 1
Figure 1: Replicon-based screenings. A) Schematic representation of the ZIKV replicon construct containing a Rluc sequence at the 5' UTR terminus and a Neo gene at the 3' UTR terminus, that we have developed to obtain the BHK-21-RepZIKV-IRES_Neo cell line 8. B) Schematic representation of the luciferase activity assay and cell proliferation-based MTT assay performed to screen for inhibitors of ZIKV replication. C) The dose-response curves (EC50 and CC50) of NITD008. The assay was performed in duplicates. Error bars represent standard deviations. Please click here to view a larger version of this figure.

Figure 2
Figure 2: Viral enzyme-based assays. A) Schematic representation of NS2B-NS3 protease activity assay. B) The dose-response inhibition curve (IC50) of compound MMV1634402. C) Schematic representation of NS5 RdRp RNA polymerase activity assay. D) The dose-response inhibition curve (IC50) of compound MMV1782220. The assays were performed in triplicates. Error bars represent standard deviations. Please click here to view a larger version of this figure.

Discussion

The protocols described herein could be readily adapted for screenings in a 384 or 1536-well formats. For biochemical and/or cell-based screenings performed in HTS format, the Z' factor value, a statistical parameter, is calculate for each plate to ensure the sensitivity, reproducibility and accuracy of those assays12. A Z' factor value of 0.5 or above is expected for replicon-based screenings while a value of 0.7 or above is expected for the NS3 and NS5 activity assays. For the replicon-based HTS, we have developed the BHK-21-RepZIKV_IRES-Neo cells, a stable cell line harboring a replicative ZIKV replicon containing a Renilla luciferase (Rluc) sequence at the 5' UTR region and a neomycin phosphotransferase (Neo) gene driven by an internal ribosomal entry site (IRES) at the 3´UTR. We retained 38 residues of capsid and 30 residues of envelop genes that are required for the correct initiation of the RNA translation, to maintain comparable replication levels and drug sensitivity between cell passages8. Due to the lack of structural genes, replicons do not produce progeny virions, thus eliminating the risk of laboratory-acquired viral infection17.

The antiviral assays using the ZIKV replicon cells consists in the luciferase activity and the cell proliferation-based MTT (cytotoxicity) assays performed in parallel. This is necessary to exclude false-positive hits, comprising molecules that interfere directly with the reporter protein expression and/or activity and those that adversely affect cell health7. Replicon systems allows the discovery of molecules that inhibit RNA replication but not those required for viral entry and virion assembly/release. Alternatively, replicons can be packaged to produce virus replicon particles (VRPs) by providing the structural proteins in trans17. The resulting single-round infectious particles (SRIPs) are infectious, but progeny virus cannot propagate as the package genome lacks structural genes. Therefore, VRPs could be used to test for inhibitors of viral entry/replication by measuring the levels of the reporter protein7.

In addition to the replicon-based screenings, we also detailed herein the protocols used in viral enzyme-based assays for the recombinant NS3 protease and NS5 RdRp. The proteolytic activity of the viral protease was measured by using the fluorogenic peptide substrate Bz-nKRR-AMC, which contains the ZIKV protease recognition and cleavage sequence coupled with the fluorescent tag 7-amine-4-methylcoumarin (AMC). Due to the protease activity, the fluorescent tag is released and the reaction rate is directly measured by monitoring the fluorescence in a spectrophotometer18,19. This assay is highly sensible, relatively cheap, quick and suitable for screening of large compound libraries20,21. The major drawback is the possible quenching between tested compounds and the fluorophore that can lead to false-positive hits. However, this issue could be addressed by an additional fluorescence measurement in the presence of AMC. Also, compounds showing emission or absorption in the same wavelength of the fluorophore cannot be evaluated by this method18,20.

Regarding the NS5 RdRp, its elongation activity is directly detected by the increase of the fluorescent signal of SYBR Green I during the elongation of a self-priming 3'UTR-U30 template. The protocol was adapted from assays with intercalating dyes such as Pico Green and SYTO 9 that have been widely used to evaluate compounds for different viral polymerases22,23,24,25,26. Even though we have used a self-priming biotinylated template27 in the assay, other templates, such as poliU, can be used as well25. The main disadvantage of this method is the high number of false-positive hits that interact with the dye, either by interfering with the fluorescence or by decreasing the dsRNA intercalation28. Therefore, hit compounds need to be validated with counter-assays such as biophysics methods or by comparing the SYBR™ Green I fluorescence in dsRNA with and without the compound29. Nevertheless, the easy implementation, direct measurement and affordability are key points to the use of fluorescence-based methods as HTS platforms, in comparison to radio-labeled or coupled assays that are difficult to implement in medium/large scale campaigns27,30,31.

Açıklamalar

The authors have nothing to disclose.

Acknowledgements

This work was supported by Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP), CEPID grant 2013/07600-3 to GO, grant 2018/05130-3 to RSF and 2016/19712-9 to ASG, and Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (grant 88887.516153/2020-00) to ASG. We would like to gratefully thank the Medicine for Malaria Ventures (MMV, www.mmv.org) and the Drugs for Neglected Diseases initiative (DNDi, www.dndi.org) for their support, design of the Pandemic Response Box and supplying the compounds.

Materials

5'-biotin-U30- ACUGGAGAUCGAUCUCCAGU -3' Dharmacon – 100 ng
96-well cell culture plates KASVI K12-096
96-well PCR Microplate KASVI K4-9610
96-well White Flat Bottom Polystyrene High Bind Microplate Corning 3922
AMC (7-amine-4-methylcoumarine) SIGMA-Aldrich 257370 100 mg
Aprotinin from bovine lung SIGMA-Aldrich A1153 10 mg
ATP JenaBioscience NU-1010-1G 1 g
Bz-nKRR-AMC International Peptides – 5 mg
Class II Biohazard Safety Cabinet ESCO
Diethyl pyrocarbonate SIGMA-Aldrich D5758 25 mL
DMSO (Dimethyl sulfoxide) SIGMA-Aldrich 472301 1 L
Dulbecco’s Modified Eagle Medium GIBCO 3760091
Fetal Bovine Serum GIBCO 12657-029 500 mL
G418 SIGMA-Aldrich A1720 Disulfate salt
Glycerol SIGMA-Aldrich G5516 1 L
HERACELL VIOS 160i CO2 incubator Thermo Scientific
MnCl2 tetrahydrate SIGMA-Aldrich 203734 25 g
MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide) Invitrogen M6494
NITD008 ≥98% (HPLC) Sigma-Aldrich SML2409 5 mg
qPCR system Mx3000P Agilent
Renilla luciferase Assay System PROMEGA E2810
SpectraMax Gemini EM Fluorescence Reader Molecular Devices
SpectraMax i3 Multi-Mode Detection Platform Molecular Devices
SpectraMax Plus 384 Absorbance Microplate Reader Molecular Devices
SYBR Green I Invitrogen S7563 500 µl
Triton X-100 SIGMA-Aldrich X100 500 mL
Trizma base SIGMA-Aldrich T1503 1 kg
Trypsin-EDTA Solution 1X SIGMA-Aldrich 59417-C 100 mL
DOWNLOAD MATERIALS LIST

Referanslar

  1. Zou, J., Shi, P. Y. Strategies for Zika drug discovery. Current Opinion in Virology. 35, 19-26 (2019).
  2. Cugola, F. R., et al. The Brazilian Zika virus strain causes birth defects in experimental models. Nature. 534 (7606), 267-271 (2016).
  3. de Araújo, T. V. B., et al. Association between microcephaly, Zika virus infection, and other risk factors in Brazil: Final report of a case-control study. The Lancet Infectious Diseases. 18 (3), 328-336 (2018).
  4. Cao-Lormeau, V. -. M., et al. Guillain-Barré Syndrome outbreak associated with Zika virus infection in French Polynesia: a case-control study. The Lancet. 387 (10027), 1531-1539 (2016).
  5. Pielnaa, P., et al. Zika virus-spread, epidemiology, genome, transmission cycle, clinical manifestation, associated challenges, vaccine and antiviral drug development. Virology. 543, 34-42 (2020).
  6. Bollati, M., et al. Structure and functionality in flavivirus NS-proteins: Perspectives for drug design Flaviviral NS3 protein Flaviviral NS5 protein Protease Helicase Polymerase Methyltransferase Flavivirus protein structure Antivirals VIZIER Consortium. Antiviral Research. 87, 125-148 (2010).
  7. Fernandes, R. S., et al. Reporter replicons for antiviral drug discovery against positive single-stranded RNA viruses. Viruses. 12 (6), (2020).
  8. Fernandes, R. S., et al. Discovery of an imidazonaphthyridine and a riminophenazine as potent anti-Zika virus agents through a replicon-based high-throughput screening. Virus Research. 299, 198388 (2021).
  9. Noske, G. D., et al. Structural characterization and polymorphism analysis of the NS2B-NS3 protease from the 2017 Brazilian circulating strain of Yellow Fever virus. Biochimica et Biophysica Acta – General Subjects. 1864 (4), 129521 (2020).
  10. Godoy, A. S., et al. Crystal structure of Zika virus NS5 RNA-dependent RNA polymerase. Nature Communications. 8, 14764 (2017).
  11. Yin, Z., et al. An adenosine nucleoside inhibitor of dengue virus. Proceedings of the National Academy of Sciences. 106 (48), 20435-20439 (2009).
  12. Zhang, J. H., Chung, T. D. Y., Oldenburg, K. R. A simple statistical parameter for use in evaluation and validation of high throughput screening assays. Journal of Biomolecular Screening. 4 (2), 67-73 (1999).
  13. Brecher, M., Zhang, J., Li, H. The flavivirus protease as a target for drug discovery. Virologica Sinica. 28 (6), 326-336 (2013).
  14. Noble, C. G., Seh, C. C., Chao, A. T., Shi, P. Y. Ligand-bound structures of the dengue virus protease reveal the active conformation. Journal of Virology. 86 (1), 438-446 (2012).
  15. Chen, X., et al. Mechanisms of activation and inhibition of Zika virus NS2B-NS3 protease. Cell Research. 26 (11), 1260-1263 (2016).
  16. Eyer, L., Nencka, R., de Clercq, E., Seley-Radtke, K., Růžek, D. Nucleoside analogs as a rich source of antiviral agents active against arthropod-borne flaviviruses. Antiviral Chemistry and Chemotherapy. 26, (2018).
  17. Xie, X., et al. Zika Virus Replicons for Drug Discovery. EBioMedicine. 12, 156-160 (2016).
  18. Pan, K. L., Lee, J. C., Sung, H. W., Chang, T. Y., Hsu, J. T. A. Development of NS3/4A protease-based reporter assay suitable for efficiently assessing hepatitis C virus infection. Antimicrobial Agents and Chemotherapy. 53 (11), 4825-4834 (2009).
  19. Khumthong, R., Angsuthanasombat, C., Panyim, S., Katzenmeier, G. In Vitro Determination of Dengue Virus Type 2 NS2B-NS3 Protease Activity with Fluorescent Peptide Substrates. Journal of Biochemistry and Molecular Biology. 35 (2), (2002).
  20. Ulanday, G. E. L., Okamoto, K., Morita, K. Development and utility of an in vitro, fluorescence-based assay for the discovery of novel compounds against dengue 2 viral protease. Tropical Medicine and Health. 44 (1), 1-10 (2016).
  21. Ong, I. L. H., Yang, K. L. Recent developments in protease activity assays and sensors. Analyst. 142 (11), 1867-1881 (2017).
  22. Eltahla, A. A., Lackovic, K., Marquis, C., Eden, J. S., White, P. A. A fluorescence-based high-throughput screen to identify small compound inhibitors of the genotype 3a hepatitis c virus RNA polymerase. Journal of Biomolecular Screening. 18 (9), 1027-1034 (2013).
  23. Eydoux, C., et al. A fluorescence-based high throughput-screening assay for the SARS-CoV RNA synthesis complex. Journal of Virological Methods. 288, 114013 (2021).
  24. Shimizu, H., et al. Discovery of a small molecule inhibitor targeting dengue virus NS5 RNA-dependent RNA polymerase. PLoS Neglected Tropical Diseases. 13 (11), 1-21 (2019).
  25. Sáez-Álvarez, Y., Arias, A., del Águila, C., Agudo, R. Development of a fluorescence-based method for the rapid determination of Zika virus polymerase activity and the screening of antiviral drugs. Scientific Reports. 9 (1), 1-11 (2019).
  26. Kocabas, F., Turan, R. D., Aslan, G. S. Fluorometric RdRp assay with self-priming RNA. Virus Genes. 50 (3), 498-504 (2015).
  27. Niyomrattanakit, P., et al. A fluorescence-based alkaline phosphatase-coupled polymerase assay for identification of inhibitors of dengue virus RNA-Dependent RNA polymerase. Journal of Biomolecular Screening. 16 (2), 201-210 (2011).
  28. Simeonov, A., Davis, M. I. . Interference with Fluorescence and Absorbance Flow Chart Fluorescence Interferences. (Md). , 1-8 (2016).
  29. Genick, C. C., et al. Applications of biophysics in high- Throughput screening hit validation. Journal of Biomolecular Screening. 19 (5), 707-714 (2014).
  30. Smith, T. M., et al. Identifying initiation and elongation inhibitors of dengue virus RNA polymerase in a high-throughput lead-finding campaign. Journal of Biomolecular Screening. 20 (1), 153-163 (2015).
  31. Porecha, R., Herschlag, D. RNA radiolabeling. Methods in enzymology. 530, 255-279 (2013).

Etiketler

Zika VirusAntiviral AssayHigh-throughput ScreeningRepliconViral EnzymeRenilla LuciferaseNS3 ProteaseNS5 RNA-dependent RNA PolymeraseRdRpBHK-21 Cell LineCell CultureTrypsinizationCompound ScreeningDMEMDMSOPositive ControlNegative ControlRenilla Luciferase Lysis Buffer

Play Video
PDF
DOI
DOWNLOAD MATERIALS LIST
Bu Makaleden Alıntı Yapın
Fernandes, R. S., Noske, G. D., Gawriljuk, V. O., de Oliveira, K. I. Z., Godoy, A. S., Mesquita, N. C. M. R., Oliva, G. High-throughput Antiviral Assays to Screen for Inhibitors of Zika Virus Replication. J. Vis. Exp. (176), e62422, doi:10.3791/62422 (2021).
Atıfı İndir
Tekrar Baskılar ve İzinler

View Video

✖

To prove you're not a robot, please enter the text in the image below

CAPTCHA Image
Play CAPTCHA Audio
Refresh Image