JoVE Journal > Biochemistry
Summary
Abstract
Introduction
Protocol
Results
Discussion
Disclosures
Acknowledgements
Materials
References
עברית

Automatically Generated
Please note that all translations are automatically generated. Click here for the English version.
Biochemistry

פינצטה אופטית לחקר אינטראקציות בין RNA לחלבון בוויסות התרגום

Published: February 12, 2022
doi:
10.3791/62589
, ,
1Helmholtz Institute for RNA-based Infection Research (HIRI),Helmholtz Zentrum für Infektionsforschung (Helmholtz Centre for Infection Research), 2Medical Faculty,Julius-Maximilians University Würzburg

Summary

פרוטוקול זה מציג זרימת עבודה ניסיונית מלאה לחקר אינטראקציות חלבון RNA באמצעות פינצטה אופטית. מספר הגדרות ניסיוניות אפשריות מתארות כולל שילוב של פינצטה אופטית עם מיקרוסקופיה קונפוקלית.

Abstract

RNA מאמצת קפלים מבניים מגוונים, החיוניים לתפקודיו ובכך יכולים להשפיע על תהליכים מגוונים בתא. בנוסף, המבנה והתפקוד של RNA יכול להיות מווסת על ידי גורמים טרנס-משחק שונים, כגון חלבונים, מטבוליטים או RNAs אחרים. מולקולות RNA משניות מסגרת, למשל, הן RNAs תקינים הממוקמים באזורי קידוד, אשר מכוונים את הריבוזומים למסגרת קריאה פתוחה חלופית, ובכך פועלים כמתגי גנים. הם עשויים גם לאמץ קפלים שונים לאחר קשירה לחלבונים או גורמים טרנס אחרים. כדי לנתח את תפקידם של חלבונים מחייבי RNA בתרגום וכיצד הם מווסתים את מבנה הרנ”א ואת היציבות, חיוני ללמוד את יחסי הגומלין והמכניים של מתחמי חלבון RNA אלה בו זמנית. עבודה זו ממחישה כיצד להשתמש פינצטה אופטית מצמידה מולקולה אחת-פלואורסצנטית כדי לחקור את הנוף הקונפורמציה והתרמודינמי של מתחמי חלבון RNA ברזולוציה גבוהה. כדוגמה, האינטראקציה של ה- SARS-CoV-2 מתוכנתת מסגרת ריבוזומלית אלמנט עם גורם טרנס-משחק איזופורם קצר של חלבון אנטי ויראלי באצבע אבץ הוא פירט. בנוסף, ריבוזומים המסומנים בפלואורסצנטיות היו במעקב באמצעות יחידת הקונפוציה, אשר בסופו של דבר תאפשר את חקר התארכות התרגום. בדיקת OT בשילוב פלואורסצנטיות יכולה להיות מיושמת באופן נרחב כדי לחקור מתחמי חלבון RNA מגוונים או גורמים טרנס-משחק המסדירים תרגום ויכול להקל על מחקרים של ויסות גנים מבוססי RNA.

Introduction

העברת מידע גנטי מדנ”א לחלבונים באמצעות mRNAs הוא תהליך ביוכימי מורכב, אשר מוסדר במדויק בכל הרמות באמצעות אינטראקציות מקרומולקולריות בתוך תאים. לוויסות תרגומי, אינטראקציות בין חלבון RNA מעניקות תפקיד קריטי להגיב במהירות לגירויים ולאותות שונים1,2. אינטראקציות מסוימות של חלבון RNA משפיעות על יציבות ה-mRNA ובכך משנות את הזמן ש-RNA פעיל מבחינה תרגומית. אינטראקציות אחרות של חלבון RNA קשורות למנגנוני recoding כגון קריאת עצירת קודון, עקיפת או מיזוג מסגרת ריבוזומלי מתוכנת (PRF)3,4,5,6,7. לאחרונה, מספר חלבונים מחייבי RNA (RBPs) הוכחו לקיים אינטראקציה עם אלמנטים mRNA מגרה ומכונות התרגום כדי להכתיב מתי וכמה recoding יתרחש בתא7,8,9,10,11. לכן, כדי לנתח את התפקיד של חלבונים מחייבי RNA בתרגום וכיצד הם לווסתים מבנה RNA ויציבות, זה חיוני ללמוד את עקרונות האינטראקציה ואת המאפיינים המכניים של מתחמי חלבון RNA אלה בפירוט.

עשרות שנים של עבודה הניחו את היסודות לחקר תהליך התרגום הרב-שלבי ורב-מרכיבים, הנשען על תקשורת מורכבת בין רכיבי הרנ”א והחלבון של מכונות התרגום כדי להשיג מהירות ודיוק12,13,14. צעד מכריע הבא בהבנת אירועים רגולטוריים מורכבים הוא קביעת הכוחות, צירי הזמן ודטרמיננטות מבניות במהלך התרגום בדיוק גבוה12,15,16,17. חקר הדינמיקה הקונפורמציה של RNA ובמיוחד האופן שבו גורמי עזר טרנס-פועלים על מבנה הרנ”א במהלך התרגום הוארו עוד יותר על ידי הופעתם של כלים חד-מולקולתיים, כולל פינצטה אופטית או מגלי גל במצב אפס16,17,18,19,20,21,22,23,24 25,26.

פינצטה אופטית (OT) מייצגת טכניקה מדויקת ביותר של מולקולה אחת, אשר יושמה כדי לחקור סוגים רבים של תהליכים דינמיים תלויי RNA כולל שעתוק, ותרגום26,27,28,29,30,31,32. השימוש בפינצטה אופטית אפשר לבחן אינטראקציות מולקולריות, מבני חומצות גרעין ומאפיינים תרמודינמיים, קינטיקה ואנרגטיה של תהליכים אלה בפירוט16,17,22,33,34,35,36,37,38,39 . פינצטה אופטית מבוססת על מלכוד של עצמים מיקרוסקופיים עם קרן לייזר ממוקדת. בניסוי OT טיפוסי, מולקולת העניין קשורה בין שני חרוזים שקופים (בדרך כלל פוליסטירן) (איור 1A)27. חרוזים אלה נתפסים לאחר מכן על ידי מלכודות אופטיות, אשר מתנהגים כמו מעיינות. לפיכך, ניתן לחשב את הכוח המופעל על המולקולה בהתבסס על תזוזת החרוז ממרכז קרן הלייזר הממוקדת (מרכז המלכודת). לאחרונה, פינצטה אופטית שולבה עם מיקרוסקופיה קונפוקלית (איור 1B), המאפשרת מדידות פלואורסצנטיות או העברת אנרגיית תהודה של פורסטר (FRET)40,41,42. זה פותח שדה חדש לגמרי של ניסויים אפשריים המאפשרים מדידה סימולטונית, ולכן, מתאם מדויק של ספקטרוסקופיה כוח נתוני פלואורסצנטיות.

כאן, אנו מדגימים ניסויים באמצעות פינצטה אופטית בשילוב עם מיקרוסקופיה קונפוקלית כדי לחקור אינטראקציות חלבון-RNA המסדירות את המסגרת התרגומית. בין המטרה לבין המחזק, תא זרימה עם חמישה ערוצים מאפשר יישום מדגם רציף עם זרימת למינאר. דרך הערוצים המיקרופלואידיים, ניתן להזריק רכיבים שונים ישירות, מה שמקטין את זמן הידיים, כמו גם מאפשר צריכת מדגם קטנה מאוד לאורך הניסוי.

ראשית, מוצעת הנחיה בסיסית לסיוע בתכנון ניסויי OT ונוצבים יתרונות כמו גם מלכודות של מערכונים שונים. לאחר מכן, הכנת דגימות וזרימות עבודה ניסיוניות מתוארות, ונדפק פרוטוקול לניתוח הנתונים. כדי לייצג דוגמה, אנו מתארים את התוצאות שהתקבלו מניסויי מתיחת RNA כדי לחקור את אלמנט ה-RNA של SARS-CoV-2 (איור 2A) עם גורם הטרנס-משחק האיזופורם הקצר של חלבון אנטי-ויראלי באצבע אבץ (ZAP), המשנה את התרגום של ה-RNA הנגיפי ממסגרת קריאה חלופית43. בנוסף, הוא הוכיח כי ריבוזומים תווית פלואורסצנטית ניתן להשתמש זה OT confocal assay, אשר יהיה שימושי כדי לפקח על העיבוד ואת המהירות של מכונות התרגום. השיטה המוצגת כאן יכולה לשמש כדי לבדוק במהירות את ההשפעה של מאגרים שונים, ליגנדים או רכיבים תאיים אחרים כדי ללמוד היבטים שונים של התרגום. לבסוף, נדונים מלכודות ניסיוניות נפוצות וכיצד לפתור אותן. להלן כמה נקודות מכריעות בעיצוב ניסיוני.

עיצוב מבנה
באופן עקרוני, קיימות שתי גישות נפוצות ליצירת מבנה RNA תואם OT. הגישה הראשונה משתמשת במולקולת RNA ארוכה, המרוכזת בידיות דנ”א משלימות, ובכך מניבה מבנה המורכב משני אזורים היברידיים של רנ”א/דנ”א המאגפים רצף RNA חד-גדילי באמצע (איור 2B). גישה זו מועסקת ברוב ניסויי ה- OT RNA33,44,45.

הגישה השנייה מנצלת ידיות dsDNA עם overhangs קצר (סביב 20 nt) 15,17. ההכלאות האלה מהויברידיות עם מולקולת הרנ”א. למרות שהוא מסובך יותר בעיצוב, השימוש בידיות dsDNA מתגבר על חלק מהמגבלות של מערכת ה- DNA / RNA-היברידית. באופן עקרוני, אפילו ידיות ארוכות מאוד (>10kb) ניתן ליישם, וזה נוח יותר למדידות confocal. בנוסף, ניתן לקשור את מולקולת ה-RNA לידיות DNA כדי להגביר את יציבות הרצועה.

אסטרטגיית סימון קצה
המבנה חייב להיות קשור חרוזים באמצעות אינטראקציה מולקולרית חזקה. אמנם יש גישות זמינות עבור מליטה covalent של ידיות חרוזים46, אינטראקציות חזקות אך לא קוולנטי כגון סטרפטבידין-ביוטין ו דיגוקסיגנין-נוגדן משמשים בדרך כלל בניסויי OT15,33,35,45. בפרוטוקול המתואר, המבנה מסומן ביוטין או דיגוקסיגנין, והחרוזים מצופים בסטרפטבידין או בנוגדנים נגד דיגוקסיגנין, בהתאמה (איור 1A). גישה זו תתאים להחלת כוחות עד כ-60 pN (לכל חבל)47. יתר על כן, השימוש באסטרטגיות תיוג שונות של 5′ ו-3′ מאפשר לקבוע את הכיוון של הרצועה שנוצרה בין החרוזים17.

תיוג חלבונים למדידות פלואורסצנטיות
עבור הדמיה קונפוקלית, ישנן מספר גישות נפוצות עבור תיוג פלואורסצנטיות. לדוגמה, פלואורופורים יכולים להיות מחוברים באופן קוולנטי לשאריות חומצות אמינו שנמצאות באופן מקורי בחלבונים או מוצגות על ידי מוטגנזה מכוונת אתר באמצעות קבוצה אורגנית תגובתית. צבע תיול או אמין-תגובתי יכול לשמש לתיוג של שאריות ציסטאין וליצין, בהתאמה. ישנן מספר שיטות הגנה הפיכות כדי להגדיל את הספציפיות של labeling48,49, אולם חלבונים מקומיים בדרך כלל יסומנו בשאריות מרובות. למרות שהגודל הקטן של הפלורופור עשוי להעניק יתרון, תיוג לא ספציפי עלול להפריע לפעילות החלבון ולכן עוצמת האות עשויה להשתנות 49. כמו כן, בהתאם לעוצמת האות יעילות התיוג עשוי להיות שונה בין ניסויים שונים. לכן, יש לבצע בדיקת פעילות לפני הניסוי.

במקרה שחלבון העניין מכיל תג N-או C-terminal, כגון תג שלו או תג סטרפטופון, תיוג ספציפי של תגים אלה מייצג גישה פופולרית אחרת. יתר על כן, תיוג ממוקד תג מקטין את הסיכוי של פלואורופור מפריע לפעילות החלבון יכול לשפר את המסיסות49. עם זאת, תיוג ספציפי לתג בדרך כלל מניב חלבונים מונו-פלואורופור שכותרתו, אשר עשוי להיות מאתגר לזהות. דרך נוספת של תיוג ספציפי יכולה להתבצע על ידי שימוש בנוגדנים.

הגדרת מיקרופלואידיקה
השילוב של OT עם מערכת מיקרופלואידיקה מאפשר מעבר מהיר בין תנאי ניסוי שונים. יתר על כן, מערכות נוכחיות מנצלות את השמירה על זרימת למינאר בתוך תא הזרימה, אשר מונע ערבוב של נוזלים מערוצים אחרים בכיוון הניצב ביחס לכיוון הזרימה. לכן, זרימת למינאר היא יתרון במיוחד עבור העיצוב הניסיוני. נכון לעכשיו, תאי זרימה עם עד 5 ערוצים נמצאים בדרך כלל (איור 3).

Protocol

1. הכנת מדגם שכפל את רצף העניין בווקטור המכיל את שברי הדנ”א של למבדה, המשמשים כרצפי הידית (איור 2)43,50. תחילה צור תבנית DNA לתמלול במבחנה לאחר מכן באמצעות PCR (איור 2B; תגובה 1). בשלב PCR זה, מקדם T7 מתווסף בקצה 5 ‘ ש?…

Representative Results

בסעיף זה, המיקוד ניתן בעיקר על מדידות של אינטראקציות חלבון RNA/ ליגנד על ידי פינצטה אופטי פלואורסצנטית. לתיאור של ניסויי פינצטה אופטיים כלליים של RNA ותוצאות מייצגות מתאימות, ראה 32. לדיון מפורט יותר באינטראקציות בין RNA לחלבון DNA, ראו גם 1,2,26,59,60.</sup…

Discussion

כאן, אנו מדגימים את השימוש פינצטה אופטית בשילוב פלואורסצנטיות כדי לחקור אינטראקציות והתנהגות דינמית של מולקולות RNA עם ליגנדים שונים. להלן, נדונים צעדים קריטיים ומגבלות של הטכניקה הנוכחית.

שלבים קריטיים בפרוטוקול
באשר לשיטות רבות אחרות, איכות המדגם היא מרכזית כד?…

Disclosures

The authors have nothing to disclose.

Acknowledgements

אנו מודים לאנויה קייב וליוני פרופ’ רדמונד סמית על סקירה ביקורתית של כתב היד. אנו מודים לטטיאנה קוך על הסיוע הטכני המומחה. אנו מודים לקריסטינה פקרקובה על העזרה בהקלטת סרטונים ניסיוניים. העבודה במעבדה שלנו נתמכת על ידי איגוד הלמהולץ ומימון ממועצת המחקר האירופית (ERC) גרנט 948636 (ל- NC).

Materials

Bacterial Strains
E. coli HB101 lab collection N/A cloning of the vectors
Chemicals and enzymes
Sodium chloride Sigma-Aldrich 31424 Buffers
Biotin-16-dUTP Roche 11093070910 Biotinylation
BSA Sigma-Aldrich A4737 Buffers
Catalase Lumicks N/A Oxygen scavanger system
Dithiothreitol (DTT) Melford Labs D11000 Buffers
DNAse I from bovine pancreas Sigma-Aldrich D4527 in vitro transcription
dNTPs Th.Geyer 11786181 PCR
EDTA Sigma-Aldrich E9884 Buffers
Formamide Sigma-Aldrich 11814320001 Buffers
Glucose Sigma-Aldrich G8270-1KG Oxygen scavanger system
Glucose-oxidase Lumicks N/A Oxygen scavanger system
HEPES Carl Roth HN78.3 Buffers
Magnesium chloride Carl Roth 2189.1 Buffers
Phusion DNA polymerase NEB M0530L Gibson assembly, cloning
Potassium chloride Merck 529552-1KG Buffers
PrimeSTAR GXL DNA Polymerase Takara Bio Clontech R050A PCR
Pyrophosphotase, thermostabile, inorganic NEB M0296L in vitro transcription
RNase Inhibitor Molox 1000379515 Buffers
rNTPS life technologies R0481 in vitro transcription
Sodium thiosulophate Sigma-Aldrich S6672-500G Bleach deactivation
Sytox Green Lumicks N/A confocal measurements
T4 DNA Polymerase NEB M0203S Biotinylation
T5 exonuclease NEB M0363S Gibson assembly, cloning
T7 RNA polymerase Produced in-house N/A in vitro transcription
Taq DNA polymerase NEB M0267S PCR
Taq ligase Biozym L6060L Gibson assembly, cloning
TWEEN 20 BioXtra Sigma-Aldrich P7949 Buffers
Kits
Monolith Protein Labeling Kit RED-NHS 2nd Generation (Amine Reactive) Nanotemper MO-L011 Used for ribosome labeling
Purefrex 2.0 GeneFrontier PF201-0.25-EX Ribosomes used for the labeling
Oligonucleotides
5' handle T7 forward Microsynth custom order 5’ – CTTAATACGACTCACTATAGGTC
CTTTCTGTGGACGCC – 3’, used to generate OT in vitro transcription template in PCR 1
3’ handle reverse Microsynth custom order 5' -  GTCAAAGTGCGCCCCGTTATCC – 3', used to generate OT in vitro transcription template in PCR 1
5' handle forward Microsynth custom order 5' – TCCTTTCTGTGGACGCCGC – 3' , used to generate 5' handle in PCR 2
5’ handle reverse Microsynth custom order 5’ – CATAAATACCTCTTTACTAATATA
TATACCTTCGTAAGCTAGCGT – 3’, used to generate 5' handle in PCR 2
3’ handle forward Microsynth custom order 5' – ATCCTGCAACCTGCTCTTCGCC
AG – 3', used to generate 3' handle in PCR 3
3’ handle reverse 5’labeled with digoxigenin Microsynth custom order 5' -[Dig]-GTCAAAGTGCGCCCCGTTATCC – 3', used to generate 3' handle in PCR 3
DNA vectors
pMZ_OT produced in-house N/A further description in "Structural studies of Cardiovirus 2A protein reveal the molecular basis for RNA recognition and translational control"
Chris H. Hill, Sawsan Napthine, Lukas Pekarek, Anuja Kibe, Andrew E. Firth, Stephen C. Graham, Neva Caliskan, Ian Brierley
bioRxiv 2020.08.11.245035; doi: https://doi.org/10.1101/2020.08.11.245035
Software and Algorithms
Atom https://atom.io/packages/ide-python N/A
Bluelake Lumicks N/A
Graphpad https://www.graphpad.com/ N/A
InkScape 0.92.3 https://inkscape.org/ N/A
Matlab https://www.mathworks.com/products/matlab.html N/A
POTATO https://github.com/lpekarek/POTATO.git N/A
RNAstructure https://rna.urmc.rochester.edu/RNAstructure.html N/A
Spyder https://www.spyder-ide.org/ N/A
Other
Streptavidin Coated Polystyrene Particles, 1.5-1.9 µm, 5 ml, 1.0% w/v Spherotech SVP-15-5
Anti-digoxigenin Coated Polystyrene Particles, 2.0-2.4 µm, 2 ml, 0.1% w/v Spherotech DIGP-20-2
Syringes VWR TERUMO SS+03L1
Devices
C-trap Lumicks N/A  optical tweezers coupled with confocal microscopy
DOWNLOAD MATERIALS LIST

References

  1. Balcerak, A., Trebinska-Stryjewska, A., Konopinski, R., Wakula, M., Grzybowska, E. A. RNA-protein interactions: disorder, moonlighting and junk contribute to eukaryotic complexity. Open Biology. 9 (6), 190096 (2019).
  2. Armaos, A., Zacco, E., Sanchez de Groot, N., Tartaglia, G. G. RNA-protein interactions: Central players in coordination of regulatory networks. BioEssays. 43 (2), 2000118 (2021).
  3. Firth, A. E., Brierley, I. Non-canonical translation in RNA viruses. Journal of General Virology. 93, 1385-1409 (2012).
  4. Caliskan, N., Peske, F., Rodnina, M. V. Changed in translation: mRNA recoding by −1 programmed ribosomal frameshifting. Trends in Biochemical Sciences. 40 (5), 265-274 (2015).
  5. Jaafar, Z. A., Kieft, J. S. Viral RNA structure-based strategies to manipulate translation. Nature Reviews Microbiology. 17 (2), 110-123 (2019).
  6. Eswarappa, S. M., et al. Programmed translational readthrough generates antiangiogenic VEGF-Ax. Cell. 157 (7), 1605-1618 (2014).
  7. Rodnina, M. V., et al. Translational recoding: canonical translation mechanisms reinterpreted. Nucleic Acids Research. 48 (3), 1056-1067 (2020).
  8. Li, Y., et al. Transactivation of programmed ribosomal frameshifting by a viral protein. Proceedings of the National Academy of Sciences. 111 (21), 2172 (2014).
  9. Napthine, S., et al. Protein-directed ribosomal frameshifting temporally regulates gene expression. Nature Communications. 8 (1), 15582 (2017).
  10. Patel, A., et al. Molecular characterization of the RNA-protein complex directing -2/-1 programmed ribosomal frameshifting during arterivirus replicase expression. Journal of Biological Chemistry. 295 (52), 17904-17921 (2020).
  11. Napthine, S., Bell, S., Hill, C. H., Brierley, I., Firth, A. E. Characterization of the stimulators of protein-directed ribosomal frameshifting in Theiler’s murine encephalomyelitis virus. Nucleic Acids Research. 47 (15), 8207-8223 (2019).
  12. Marshall, R. A., Aitken, C. E., Dorywalska, M., Puglisi, J. D. Translation at the Single-Molecule Level. Annual Review of Biochemistry. 77 (1), 177-203 (2008).
  13. Rodnina, M. V. The ribosome in action: Tuning of translational efficiency and protein folding. Protein science : A publication of the Protein Society. 25 (8), 1390-1406 (2016).
  14. Rodnina, M. V., Fischer, N., Maracci, C., Stark, H. Ribosome dynamics during decoding. Philosophical Transactions of Royal Society of London B Biological Sciences. 372 (1716), (2017).
  15. Yan, S., Wen, J. D., Bustamante, C., Tinoco, I. Ribosome excursions during mRNA translocation mediate broad branching of frameshift pathways. Cell. 160 (5), 870-881 (2015).
  16. Liu, T., et al. Direct measurement of the mechanical work during translocation by the ribosome. eLife. 3, 03406 (2014).
  17. Desai, V. P., et al. Co-temporal force and fluorescence measurements reveal a ribosomal gear shift mechanism of translation regulation by structured mRNAs. Molecular Cell. 75 (5), 1007-1019 (2019).
  18. Choi, J., O’Loughlin, S., Atkins, J. F., Puglisi, J. D. The energy landscape of -1 ribosomal frameshifting. Science Advances. 6 (1), (2020).
  19. Prabhakar, A., Puglisi, E. V., Puglisi, J. D. Single-molecule fluorescence applied to translation. Cold Spring Harbor Perspectives in Biology. 11 (1), 032714 (2019).
  20. Bao, C., et al. mRNA stem-loops can pause the ribosome by hindering A-site tRNA binding. Elife. 9, 55799 (2020).
  21. Chen, J., Tsai, A., O’Leary, S. E., Petrov, A., Puglisi, J. D. Unraveling the dynamics of ribosome translocation. Current Opinion in Structural Biology. 22 (6), 804-814 (2012).
  22. Qu, X., et al. The ribosome uses two active mechanisms to unwind messenger RNA during translation. Nature. 475 (7354), 118-121 (2011).
  23. Zheng, Q., et al. Ultra-stable organic fluorophores for single-molecule research. Chemical Society Reviews. 43 (4), 1044-1056 (2014).
  24. Blanchard, S. C. Single-molecule observations of ribosome function. Current Opinion in Structural Biology. 19 (1), 103-109 (2009).
  25. Juette, M. F., et al. The bright future of single-molecule fluorescence imaging. Current Opinion in Chemical Biology. 20, 103-111 (2014).
  26. McCauley, M. J., Williams, M. C. Mechanisms of DNA binding determined in optical tweezers experiments. Biopolymers. 85 (2), 154-168 (2007).
  27. Ashkin, A., Dziedzic, J. M., Bjorkholm, J. E., Chu, S. Observation of a single-beam gradient force optical trap for dielectric particles. Optics Letters. 11 (5), 288-290 (1986).
  28. Bustamante, C., Smith, S. B., Liphardt, J., Smith, D. Single-molecule studies of DNA mechanics. Current Opinion in Structural Biology. 10 (3), 279-285 (2000).
  29. Choudhary, D., Mossa, A., Jadhav, M., Cecconi, C. Bio-molecular applications of recent developments in optical tweezers. Biomolecules. 9 (1), 23 (2019).
  30. Moffitt, J. R., Chemla, Y. R., Smith, S. B., Bustamante, C. Recent advances in optical tweezers. Annual Reviews of Biochemistry. 77, 205-228 (2008).
  31. Li, P. T. X., Vieregg, J., Tinoco, I. How RNA Unfolds and Refolds. Annual Review of Biochemistry. 77 (1), 77-100 (2008).
  32. Stephenson, W., Wan, G., Tenenbaum, S. A., Li, P. T. Nanomanipulation of single RNA molecules by optical tweezers. Journal of Visualized Experiments. (90), e51542 (2014).
  33. Halma, M. T. J., Ritchie, D. B., Cappellano, T. R., Neupane, K., Woodside, M. T. Complex dynamics under tension in a high-efficiency frameshift stimulatory structure. Proceedings of the National Academy of Sciences. 116 (39), 19500 (2019).
  34. Hansen, T. M., Reihani, S. N. S., Oddershede, L. B., Sørensen, M. A. Correlation between mechanical strength of messenger RNA pseudoknots and ribosomal frameshifting. Proceedings of the National Academy of Sciences of the United States of America. 104 (14), 5830-5835 (2007).
  35. Zhong, Z., et al. Mechanical unfolding kinetics of the SRV-1 gag-pro mRNA pseudoknot: possible implications for -1 ribosomal frameshifting stimulation. Science Reports. 6, 39549 (2016).
  36. McCauley, M. J., Rouzina, I., Li, J., Núñez, M. E., Williams, M. C. Significant differences in RNA structure destabilization by HIV-1 GagDp6 and NCp7 proteins. Viruses. 12 (5), 484 (2020).
  37. de Messieres, M., et al. Single-molecule measurements of the CCR5 mRNA unfolding pathways. Biophysics Journal. 106 (1), 244-252 (2014).
  38. Yang, L., et al. Single-molecule mechanical folding and unfolding of RNA hairpins: Effects of single A-U to A·C pair substitutions and single proton binding and implications for mRNA structure-induced -1 ribosomal frameshifting. Journal of American Chemical Society. 140 (26), 8172-8184 (2018).
  39. McCauley, M. J., et al. Targeted binding of nucleocapsid protein transforms the folding landscape of HIV-1 TAR RNA. Proceedings of the National Academy of Sciences of the United States of America. 112 (44), 13555-13560 (2015).
  40. Whitley, K. D., Comstock, M. J., Chemla, Y. R. High-resolution "Fleezers": Dual-trap optical tweezers combined with single-molecule fluorescence detection. Methods in Molecular Biology. 1486, 183-256 (2017).
  41. Yerramilli, V. S., Kim, K. H. Labeling RNAs in live cells using malachite green aptamer scaffolds as fluorescent probes. ACS Synthetic Biology. 7 (3), 758-766 (2018).
  42. Gross, P., Farge, G., Peterman, E. J., Wuite, G. J. Combining optical tweezers, single-molecule fluorescence microscopy, and microfluidics for studies of DNA-protein interactions. Methods in Enzymology. 475, 427-453 (2010).
  43. Zimmer, M. M., et al. The short isoform of the host antiviral protein ZAP acts as an inhibitor of SARS-CoV-2 programmed ribosomal frameshifting. Nature Communications. 12 (1), 7193 (2021).
  44. Neupane, K., Yu, H., Foster, D. A. N., Wang, F., Woodside, M. T. Single-molecule force spectroscopy of the add adenine riboswitch relates folding to regulatory mechanism. Nucleic acids research. 39 (17), 7677-7687 (2011).
  45. Ritchie, D. B., Soong, J., Sikkema, W. K., Woodside, M. T. Anti-frameshifting ligand reduces the conformational plasticity of the SARS virus pseudoknot. Journal of the American Chemical Society. 136 (6), 2196-2199 (2014).
  46. Janissen, R., et al. Invincible DNA tethers: covalent DNA anchoring for enhanced temporal and force stability in magnetic tweezers experiments. Nucleic Acids Research. 42 (18), 137 (2014).
  47. Smith, S. B., Cui, Y., Bustamante, C. Overstretching B-DNA: The elastic response of individual double-stranded and single-stranded DNA molecules. Science. 271 (5250), 795 (1996).
  48. Puljung, M. C., Zagotta, W. N. Labeling of specific cysteines in proteins using reversible metal protection. Biophysical Journal. 100 (10), 2513-2521 (2011).
  49. Toseland, C. P. Fluorescent labeling and modification of proteins. Journal of Chemical Biology. 6 (3), 85-95 (2013).
  50. Hill, C. H., et al. Structural and molecular basis for Cardiovirus 2A protein as a viral gene expression switch. Nature Communications. 12 (1), 7166 (2021).
  51. Butterworth, S. On the theory of filter amplifiers. Experimental Wireless and the Wireless Engineer. 7, 536-541 (1930).
  52. Wang, M. D., Yin, H., Landick, R., Gelles, J., Block, S. M. Stretching DNA with optical tweezers. Biophysics Journal. 72 (3), 1335-1346 (1997).
  53. Mukhortava, A., et al. Structural heterogeneity of attC integron recombination sites revealed by optical tweezers. Nucleic Acids Research. 47 (4), 1861-1870 (2019).
  54. Buck, S., Pekarek, L., Caliskan, N. POTATO: An automated pipeline for batch analysis of optical tweezers data. bioRxiv. , (2021).
  55. Zhang, Y., Jiao, J., Rebane, A. A. Hidden Markov modeling with detailed balance and its application to single protein folding. Biophysical Journal. 111 (10), 2110-2124 (2016).
  56. Sgouralis, I., Pressé, S. An introduction to infinite HMMs for single-molecule data analysis. Biophysics Journal. 112 (10), 2021-2029 (2017).
  57. Müllner, F. E., Syed, S., Selvin, P. R., Sigworth, F. J. Improved hidden Markov models for molecular motors, part 1: basic theory. Biophysical Journal. 99 (11), 3684-3695 (2010).
  58. Elms, P. J., Chodera, J. D., Bustamante, C. J., Marqusee, S. Limitations of constant-force-feedback experiments. Biophysical Journal. 103 (7), 1490-1499 (2012).
  59. Re, A., Joshi, T., Kulberkyte, E., Morris, Q., Workman, C. T. RNA-protein interactions: an overview. Methods Molecular Biology. 1097, 491-521 (2014).
  60. Jankowsky, E., Harris, M. E. Specificity and nonspecificity in RNA-protein interactions. Nature reviews. Molecular Cell Biology. 16 (9), 533-544 (2015).
  61. Lim, F., Peabody, D. S. RNA recognition site of PP7 coat protein. Nucleic Acids Research. 30 (19), 4138-4144 (2002).
  62. Sunbul, M., Jäschke, A. SRB-2: a promiscuous rainbow aptamer for live-cell RNA imaging. Nucleic Acids Research. 46 (18), 110 (2018).
  63. Sanchez de Groot, N., et al. RNA structure drives interaction with proteins. Nature Communications. 10 (1), 3246 (2019).
  64. Zeffman, A., Hassard, S., Varani, G., Lever, A. The major HIV-1 packaging signal is an extended bulged stem loop whose structure is altered on interaction with the Gag polyprotein. Journal of Molecular Biology. 297 (4), 877-893 (2000).
  65. Mangeol, P., et al. Probing ribosomal protein-RNA interactions with an external force. Proceedings of the National Academy of Sciences. 108 (45), 18272 (2011).
  66. Luo, X., et al. Molecular mechanism of RNA recognition by Zinc-Finger antiviral protein. Cell Reports. 30 (1), 46-52 (2020).
  67. Qu, X., Lancaster, L., Noller, H. F., Bustamante, C., Tinoco, I. Ribosomal protein S1 unwinds double-stranded RNA in multiple steps. Proceedings of the National Academy of Science U. S. A. 109 (36), 14458-14463 (2012).
  68. Chandra, V., Hannan, Z., Xu, H., Mandal, M. Single-molecule analysis reveals multi-state folding of a guanine riboswitch. Nature Chemical Biology. 13 (2), 194-201 (2017).
  69. Savinov, A., Perez, C. F., Block, S. M. Single-molecule studies of riboswitch folding. Biochimica et Biophysica Acta. 1839 (10), 1030-1045 (2014).
  70. Kelly, J. A., et al. Structural and functional conservation of the programmed ribosomal frameshift signal of SARS coronavirus 2 (SARS-CoV-2). Journal of Biological Chemistry. 295 (31), 10741-10748 (2020).
  71. Neupane, K., et al. Structural dynamics of single SARS-CoV-2 pseudoknot molecules reveal topologically distinct conformers. Nature Communications. 12 (1), 4749 (2021).
  72. Schindelin, J., et al. Fiji: an open-source platform for biological-image analysis. Nature Methods. 9 (7), 676-682 (2012).
  73. Zheng, Q., Jockusch, S., Zhou, Z., Blanchard, S. C. The contribution of reactive oxygen species to the photobleaching of organic fluorophores. Photochemistry and Photobiology. 90 (2), 448-454 (2014).
  74. Deerinck, T. J. The application of fluorescent quantum dots to confocal, multiphoton, and electron microscopic imaging. Toxicologic Pathology. 36 (1), 112-116 (2008).
  75. Rill, N., Mukhortava, A., Lorenz, S., Tessmer, I. Alkyltransferase-like protein clusters scan DNA rapidly over long distances and recruit NER to alkyl-DNA lesions. Proceedings of the National Academy of Science U. S. A. 117 (17), 9318-9328 (2020).
  76. Swoboda, M., et al. Enzymatic oxygen scavenging for photostability without pH drop in single-molecule experiments. ACS Nano. 6 (7), 6364-6369 (2012).
  77. Aitken, C. E., Marshall, R. A., Puglisi, J. D. An oxygen scavenging system for improvement of dye stability in single-molecule fluorescence experiments. Biophysical Journal. 94 (5), 1826-1835 (2008).
  78. Wen, J. -. D., et al. Force unfolding kinetics of RNA using optical tweezers. I. Effects of experimental variables on measured results. Biophysical journal. 92 (9), 2996-3009 (2007).

Tags

Optical TweezersRNA-protein InteractionsTranslation RegulationSingle Molecule TechniquesFluorescence Assisted Optical TweezersForce-ramp ExperimentsConstant Force MeasurementsReal-time VisualizationDNA-RNA ConstructIn-vitro TranscriptionPCR Reactions

Play Video
PDF
DOI
DOWNLOAD MATERIALS LIST
Cite This Article
Pekarek, L., Buck, S., Caliskan, N. Optical Tweezers to Study RNA-Protein Interactions in Translation Regulation. J. Vis. Exp. (180), e62589, doi:10.3791/62589 (2022).
Download Citation
Reprints and Permissions

View Video

✖

To prove you're not a robot, please enter the text in the image below

CAPTCHA Image
Play CAPTCHA Audio
Refresh Image