JoVE Journal > Biochemistry
Summary
Abstract
Introduction
Protocol
Results
Discussion
Disclosures
Acknowledgements
Materials
References
العربية

Automatically Generated
Please note that all translations are automatically generated. Click here for the English version.
Biochemistry

ملاقط بصرية لدراسة التفاعلات بين الحمض النووي الريبي والبروتين في تنظيم الترجمة

Published: February 12, 2022
doi:
10.3791/62589
, ,
1Helmholtz Institute for RNA-based Infection Research (HIRI),Helmholtz Zentrum für Infektionsforschung (Helmholtz Centre for Infection Research), 2Medical Faculty,Julius-Maximilians University Würzburg

Summary

يقدم هذا البروتوكول سير عمل تجريبي كامل لدراسة التفاعلات بين الحمض النووي الريبي والبروتين باستخدام الملاقط البصرية. يتم تحديد العديد من الاجهزة التجريبية المحتملة بما في ذلك الجمع بين الملاقط البصرية مع المجهر confocal.

Abstract

يعتمد الجيش الملكي النيبالي طيات هيكلية متنوعة ، والتي تعتبر ضرورية لوظائفه وبالتالي يمكن أن تؤثر على العمليات المتنوعة في الخلية. بالإضافة إلى ذلك ، يمكن تعديل بنية ووظيفة الحمض النووي الريبي من خلال عوامل مختلفة عابرة للمفعول ، مثل البروتينات أو الأيض أو الحمض النووي الريبي الآخر. فجزيئات الحمض النووي الريبي المتحولة الإطارية، على سبيل المثال، هي RNAs تنظيمية تقع في مناطق الترميز، والتي تترجم الريبوسومات مباشرة إلى إطار قراءة مفتوح بديل، وبالتالي تعمل كمفاتيح جين. كما أنها قد تعتمد طيات مختلفة بعد ربط البروتينات أو غيرها من العوامل العابرة. لتشريح دور البروتينات الملزمة للجيش الملكي النيبالي في الترجمة وكيفية تعديل هيكل واستقرار الحمض النووي الريبي ، من الأهمية بمكان دراسة التفاعل والسمات الميكانيكية لهذه المجمعات بروتين الحمض النووي الريبي في وقت واحد. يوضح هذا العمل كيفية استخدام ملاقط بصرية مقترنة بجزيء واحد لاستكشاف المناظر الطبيعية التوافقية والديناميكية الحرارية لمجمعات بروتين الحمض النووي الريبي بدقة عالية. وكمثال على ذلك، يتم تفصيل تفاعل عنصر نقل الإطارات الريبوسومية المبرمجة سارس-CoV-2 مع العامل العابر للمفعول القصير isoform من البروتين المضاد للفيروسات بإصبع الزنك. وبالإضافة إلى ذلك، تم رصد الريبوسومات ذات العلامات الفلورية باستخدام الوحدة الكونفوكوكال، التي ستمكن في نهاية المطاف من دراسة استطالة الترجمة. يمكن تطبيق المقايسة الفلورية المقترنة OT على نطاق واسع لاستكشاف مجمعات بروتين الحمض النووي الريبي المتنوعة أو العوامل العابرة للمفعول التي تنظم الترجمة ويمكن أن تسهل دراسات تنظيم الجينات القائم على الحمض النووي الريبي.

Introduction

نقل المعلومات الوراثية من الحمض النووي إلى البروتينات من خلال الحمض النووي الريبي هو عملية كيميائية حيوية معقدة، والتي يتم تنظيمها بدقة على جميع المستويات من خلال التفاعلات الجزيئية الكلية داخل الخلايا. للتنظيم الترجمي، تمنح التفاعلات بين الحمض النووي الريبي والبروتين دورا حاسما للتفاعل بسرعة مع مختلف المحفزات والإشارات1,2. تؤثر بعض التفاعلات بين الحمض النووي الريبي والبروتين على استقرار الحمض النووي الريبي وبالتالي تغير الوقت الذي يكون فيه الحمض النووي الريبي نشطا بشكل ترجمي. وترتبط التفاعلات الأخرى بين الحمض النووي الريبي والبروتين بآليات إعادة ترميز مثل إعادة معاينة وقف كودون، أو تجاوز، أو برمجة الريبوسومات frameshifting (PRF)3،4،5،6،7. في الآونة الأخيرة، تم إثبات عدد من البروتينات ملزمة الحمض النووي الريبي (RBPs) للتفاعل مع عناصر مرنا التحفيزية وآلية الترجمة لإملاء متى وكم إعادة ترميز سيحدث في الخلية7،8،9،10،11. وهكذا، لتشريح دور البروتينات ملزمة الحمض النووي الريبي في الترجمة وكيف تعدل هيكل الجيش الملكي النيبالي والاستقرار، فمن المحوري لدراسة مبادئ التفاعل والخصائص الميكانيكية لهذه المجمعات الحمض النووي الريبي البروتين بالتفصيل.

وقد أرست عقود من العمل الأساس لدراسة عملية الترجمة متعددة الخطوات والمتعددة المكونات، والتي تعتمد على التواصل المعقد بين الحمض النووي الريبي ومكونات البروتين في آلية الترجمة لتحقيق السرعة والدقة12,13,14. وتتمثل الخطوة الحاسمة التالية في فهم الأحداث التنظيمية المعقدة في تحديد القوى والجداول الزمنية والمحددات الهيكلية أثناء الترجمة بدقة عالية12,15,16,17. وقد تم تسليط الضوء على دراسة الديناميات تشكيل الحمض النووي الريبي وخاصة كيف تعمل العوامل المساعدة عبر المفعول على هيكل الجيش الملكي النيبالي أثناء الترجمة من خلال ظهور أدوات جزيء واحد، بما في ذلك ملاقط بصرية أو أدلة موجة وضع الصفر16،17،18،19،20،21،22،23،24 25,26

تمثل الملاقط البصرية (OT) تقنية جزيء واحد دقيقة للغاية ، والتي تم تطبيقها لدراسة أنواع عديدة من العمليات الديناميكية المعتمدة على الحمض النووي الريبي بما في ذلك النسخ والترجمة26،27،28،29،30،31،32. وقد سمح استخدام الملاقط البصرية التحقيق في التفاعلات الجزيئية، وهياكل الحمض النووي، والخصائص الحرارية، والحركية، وحيوية من هذه العمليات بالتفصيل16،17،22،33،34،35،36،37،38،39 . ويستند المقايسة ملاقط البصرية على الفخ من الأجسام المجهرية مع شعاع ليزر مركزة. في تجربة OT النموذجية ، يرتبط جزيء الاهتمام بين حبتين شفافتين (عادة البوليسترين) (الشكل 1A)27. ثم يتم القبض على هذه الخرز من قبل الفخاخ البصرية، والتي تتصرف مثل الينابيع. وهكذا، يمكن حساب القوة المطبقة على الجزيء على أساس إزاحة الخرزة من مركز شعاع الليزر المركز (مركز الفخ). في الآونة الأخيرة، تم الجمع بين الملاقط البصرية مع المجهر الكونفوج (الشكل 1B)، مما مكن من الفلورسينس أو Förster نقل الطاقة الرنين (FRET) القياسات40،41،42. وهذا يفتح مجالا جديدا كليا للتجارب الممكنة التي تسمح بالقياس المتزامن، وبالتالي الارتباط الدقيق لبيانات التحليل الطيفي للقوة والفلورسينس.

هنا، ونحن نظهر التجارب باستخدام ملاقط بصرية جنبا إلى جنب مع المجهر confocal لدراسة التفاعلات البروتين الحمض النووي الريبي تنظيم تحويل الإطارات المترجمة. بين الهدف والمكثف، خلية تدفق مع خمس قنوات تمكن التطبيق عينة مستمرة مع تدفق صفح. من خلال قنوات microfluidic ، يمكن حقن مكونات مختلفة مباشرة ، مما يقلل من الوقت العملي بالإضافة إلى السماح باستهلاك عينة قليلة جدا طوال التجربة.

أولا ، يقترح مبدأ توجيهي أساسي للمساعدة في تصميم تجارب OT ويتم مناقشة مزايا وكذلك مزالق الأجهزة المختلفة. بعد ذلك، يتم وصف إعداد العينات وسير العمل التجريبي، ويتم توفير بروتوكول لتحليل البيانات. لتمثيل مثال على ذلك، نوضح النتائج التي تم الحصول عليها من تجارب تمديد الحمض النووي الريبي لدراسة عنصر الحمض النووي الريبي المتحول من سارس-CoV-2 (الشكل 2A) مع عامل المفعول العابر للنمط القصير من البروتين المضاد للفيروسات بأصابع الزنك (ZAP)، والذي يغير ترجمة الحمض النووي الريبي الفيروسي من إطار قراءة بديل43. بالإضافة إلى ذلك، فإنه ثبت أن الريبوسومات ذات العلامات الفلورية يمكن استخدامها في هذا الفحص الكونفوجال OT، والتي من شأنها أن تكون مفيدة لرصد عملية وسرعة آلات الترجمة. يمكن استخدام الطريقة المعروضة هنا لاختبار تأثير المخازن المؤقتة المختلفة أو الليجاند أو المكونات الخلوية الأخرى بسرعة لدراسة جوانب مختلفة من الترجمة. وأخيرا، تتم مناقشة المزالق التجريبية الشائعة وكيفية استكشافها وإصلاحها. فيما يلي بعض النقاط الحاسمة في التصميم التجريبي موضحة.

تصميم البناء
من حيث المبدأ ، هناك نهجان مشتركان لإنشاء بناء الحمض النووي الريبي المتوافق مع OT. يستخدم النهج الأول جزيء الحمض النووي الريبي الطويل الذي يتم تهجينه مع مقابض الحمض النووي التكميلية ، مما يؤدي إلى بناء يتكون من منطقتين هجينتين من الحمض النووي الريبي / الحمض النووي يحيطان بتسلسل الحمض النووي الريبي أحادي التقطعت به السبل في الوسط (الشكل 2B). ويستخدم هذا النهج في معظم التجارب OT الجيش الملكي النيبالي33,44,45.

النهج الثاني يستفيد من مقابض dsDNA مع قصيرة (حوالي 20 NT) يتدلى15,17. ثم يتم تهجين هذه المعلقات مع جزيء الحمض النووي الريبي. على الرغم من أن أكثر تعقيدا في التصميم، واستخدام مقابض dsDNA يتغلب على بعض القيود المفروضة على الحمض النووي / الجيش الملكي النيبالي الهجين النظام. من حيث المبدأ ، حتى مقابض طويلة جدا (>10kb) يمكن تنفيذها ، وهو أكثر ملاءمة لقياسات confocal. بالإضافة إلى ذلك ، يمكن ربط جزيء الحمض النووي الريبي بمقابض الحمض النووي لزيادة استقرار الحبل.

استراتيجية وضع العلامات النهائية
يجب ربط البناء بالخرز عن طريق تفاعل جزيئي قوي. في حين أن هناك نهج متاحة للترابط التكافؤي للمقابض إلى الخرز46 ، فإن التفاعلات القوية ولكن غير التكافؤية مثل streptavidin-biotin و digoxigenin-antibody تستخدم عادة في تجارب OT15،33،35،45. في البروتوكول الموصوف ، يتم تسمية البناء بالبيوتين أو الديجوكسيجينين ، والخرز مغلف بالستريبتافيدين أو الأجسام المضادة ضد الديجوكسيجينين ، على التوالي (الشكل 1A). وسيكون هذا النهج مناسبا لتطبيق القوات التي تصل إلى حوالي 60 pN (لكل حبل)47. وعلاوة على ذلك، فإن استخدام مختلف استراتيجيات وضع العلامات 5 و 3 ‘تسمح بتحديد اتجاه الحبل شكلت بين الخرز17.

وضع العلامات على البروتين لقياسات الفلورسينس
للتصوير الكونفوكوكال، هناك العديد من النهج الشائعة الاستخدام لعلامات الفلورسينس. على سبيل المثال، يمكن ربط الفلوروفوريس بشكل مشترك ببقايا الأحماض الأمينية الموجودة أصلا في البروتينات أو التي يتم إدخالها عن طريق تكوين الطفرات الموجه من الموقع من خلال مجموعة عضوية تفاعلية. يمكن استخدام الأصباغ الثيول أو أمين التفاعلية لتسمية بقايا السيستين واليسين، على التوالي. هناك العديد من طرق الحماية القابلة للعكس لزيادة خصوصية وضع العلامات48,49 ، ولكن عادة ما يتم تصنيف البروتينات الأصلية على بقايا متعددة. على الرغم من أن صغر حجم الفلوروفور قد يمنح ميزة، إلا أن وضع العلامات غير المحددة قد يتعارض مع نشاط البروتين وبالتالي قد تختلف كثافة الإشارة49. أيضا، اعتمادا على كثافة إشارة كفاءة وضع العلامات قد تختلف بين التجارب المختلفة. لذلك، يجب إجراء فحص نشاط قبل التجربة.

في حالة أن البروتين من الفائدة يحتوي على علامة N- أو C-المحطة الطرفية، مثل له العلامة أو بكتيريا العلامة، وسم محددة من هذه العلامات يمثل نهجا آخر شعبية. وعلاوة على ذلك، فإن وضع العلامات المستهدفة يقلل من فرصة تدخل الفلوروفور في نشاط البروتين ويمكن أن يعزز قابلية الذوبان49. ومع ذلك، فإن وضع العلامات الخاصة بالعلامة عادة ما ينتج بروتينات أحادية الفلوروفورية، والتي قد يكون من الصعب اكتشافها. ويمكن تحقيق طريقة أخرى للوسم محددة من خلال استخدام الأجسام المضادة.

إعداد الموائع الدقيقة
مزيج من OT مع نظام microfluidics يسمح الانتقال السريع بين الظروف التجريبية المختلفة. وعلاوة على ذلك، تستفيد الأنظمة الحالية من الحفاظ على تدفق صفح داخل خلية التدفق، مما يحول دون خلط السوائل من قنوات أخرى في الاتجاه العامودي بالنسبة لاتجاه التدفق. لذلك ، فإن تدفق صفح مفيد بشكل خاص للتصميم التجريبي. حاليا، يتم استخدام خلايا التدفق مع ما يصل إلى 5 قنوات عادة (الشكل 3).

Protocol

1. إعداد العينة استنساخ تسلسل الاهتمام في المتجه الذي يحتوي على شظايا الحمض النووي لامبدا، والتي هي بمثابة تسلسل مقبض (الشكل 2)43،50. أولا توليد قالب الحمض النووي للنسخ اللاحق في المختبر عن طريق PCR (الشكل 2B</str…

Representative Results

في هذا القسم، يتم التركيز بشكل رئيسي على قياسات التفاعلات بين الحمض النووي الريبي وبروتين/ليغاند بواسطة الملاقط البصرية الفلورية. للحصول على وصف لتجارب ملاقط RNA البصرية العامة والنتائج التمثيلية المقابلة ، انظر32. لمزيد من التفاصيل حول التفاعلات بين الحمض النووي الريبي والب?…

Discussion

هنا، ونحن نظهر استخدام الملاقط البصرية المفلورة إلى جانب لدراسة التفاعلات والسلوك الديناميكي لجزيئات الحمض النووي الريبي مع مختلف ليغاندس. فيما يلي، تتم مناقشة الخطوات والقيود الهامة لهذه التقنية.

الخطوات الهامة في البروتوكول
أما بالنسبة للعديد من الطرق الأخر…

Disclosures

The authors have nothing to disclose.

Acknowledgements

نشكر أنوجا كيبي و جون البروفيسور ريدموند سميث على المراجعة النقدية للمخطوطة. نشكر تاتيانا كوخ على المساعدة التقنية الخبيرة. نشكر كريستينا بيكاركوفا على المساعدة في تسجيل مقاطع الفيديو التجريبية. يتم دعم العمل في مختبرنا من قبل جمعية هيلمهولتز وتمويل من مجلس البحوث الأوروبي (ERC) غرانت nr. 948636 (إلى NC).

Materials

Bacterial Strains
E. coli HB101 lab collection N/A cloning of the vectors
Chemicals and enzymes
Sodium chloride Sigma-Aldrich 31424 Buffers
Biotin-16-dUTP Roche 11093070910 Biotinylation
BSA Sigma-Aldrich A4737 Buffers
Catalase Lumicks N/A Oxygen scavanger system
Dithiothreitol (DTT) Melford Labs D11000 Buffers
DNAse I from bovine pancreas Sigma-Aldrich D4527 in vitro transcription
dNTPs Th.Geyer 11786181 PCR
EDTA Sigma-Aldrich E9884 Buffers
Formamide Sigma-Aldrich 11814320001 Buffers
Glucose Sigma-Aldrich G8270-1KG Oxygen scavanger system
Glucose-oxidase Lumicks N/A Oxygen scavanger system
HEPES Carl Roth HN78.3 Buffers
Magnesium chloride Carl Roth 2189.1 Buffers
Phusion DNA polymerase NEB M0530L Gibson assembly, cloning
Potassium chloride Merck 529552-1KG Buffers
PrimeSTAR GXL DNA Polymerase Takara Bio Clontech R050A PCR
Pyrophosphotase, thermostabile, inorganic NEB M0296L in vitro transcription
RNase Inhibitor Molox 1000379515 Buffers
rNTPS life technologies R0481 in vitro transcription
Sodium thiosulophate Sigma-Aldrich S6672-500G Bleach deactivation
Sytox Green Lumicks N/A confocal measurements
T4 DNA Polymerase NEB M0203S Biotinylation
T5 exonuclease NEB M0363S Gibson assembly, cloning
T7 RNA polymerase Produced in-house N/A in vitro transcription
Taq DNA polymerase NEB M0267S PCR
Taq ligase Biozym L6060L Gibson assembly, cloning
TWEEN 20 BioXtra Sigma-Aldrich P7949 Buffers
Kits
Monolith Protein Labeling Kit RED-NHS 2nd Generation (Amine Reactive) Nanotemper MO-L011 Used for ribosome labeling
Purefrex 2.0 GeneFrontier PF201-0.25-EX Ribosomes used for the labeling
Oligonucleotides
5' handle T7 forward Microsynth custom order 5’ – CTTAATACGACTCACTATAGGTC
CTTTCTGTGGACGCC – 3’, used to generate OT in vitro transcription template in PCR 1
3’ handle reverse Microsynth custom order 5' -  GTCAAAGTGCGCCCCGTTATCC – 3', used to generate OT in vitro transcription template in PCR 1
5' handle forward Microsynth custom order 5' – TCCTTTCTGTGGACGCCGC – 3' , used to generate 5' handle in PCR 2
5’ handle reverse Microsynth custom order 5’ – CATAAATACCTCTTTACTAATATA
TATACCTTCGTAAGCTAGCGT – 3’, used to generate 5' handle in PCR 2
3’ handle forward Microsynth custom order 5' – ATCCTGCAACCTGCTCTTCGCC
AG – 3', used to generate 3' handle in PCR 3
3’ handle reverse 5’labeled with digoxigenin Microsynth custom order 5' -[Dig]-GTCAAAGTGCGCCCCGTTATCC – 3', used to generate 3' handle in PCR 3
DNA vectors
pMZ_OT produced in-house N/A further description in "Structural studies of Cardiovirus 2A protein reveal the molecular basis for RNA recognition and translational control"
Chris H. Hill, Sawsan Napthine, Lukas Pekarek, Anuja Kibe, Andrew E. Firth, Stephen C. Graham, Neva Caliskan, Ian Brierley
bioRxiv 2020.08.11.245035; doi: https://doi.org/10.1101/2020.08.11.245035
Software and Algorithms
Atom https://atom.io/packages/ide-python N/A
Bluelake Lumicks N/A
Graphpad https://www.graphpad.com/ N/A
InkScape 0.92.3 https://inkscape.org/ N/A
Matlab https://www.mathworks.com/products/matlab.html N/A
POTATO https://github.com/lpekarek/POTATO.git N/A
RNAstructure https://rna.urmc.rochester.edu/RNAstructure.html N/A
Spyder https://www.spyder-ide.org/ N/A
Other
Streptavidin Coated Polystyrene Particles, 1.5-1.9 µm, 5 ml, 1.0% w/v Spherotech SVP-15-5
Anti-digoxigenin Coated Polystyrene Particles, 2.0-2.4 µm, 2 ml, 0.1% w/v Spherotech DIGP-20-2
Syringes VWR TERUMO SS+03L1
Devices
C-trap Lumicks N/A  optical tweezers coupled with confocal microscopy
DOWNLOAD MATERIALS LIST

References

  1. Balcerak, A., Trebinska-Stryjewska, A., Konopinski, R., Wakula, M., Grzybowska, E. A. RNA-protein interactions: disorder, moonlighting and junk contribute to eukaryotic complexity. Open Biology. 9 (6), 190096 (2019).
  2. Armaos, A., Zacco, E., Sanchez de Groot, N., Tartaglia, G. G. RNA-protein interactions: Central players in coordination of regulatory networks. BioEssays. 43 (2), 2000118 (2021).
  3. Firth, A. E., Brierley, I. Non-canonical translation in RNA viruses. Journal of General Virology. 93, 1385-1409 (2012).
  4. Caliskan, N., Peske, F., Rodnina, M. V. Changed in translation: mRNA recoding by −1 programmed ribosomal frameshifting. Trends in Biochemical Sciences. 40 (5), 265-274 (2015).
  5. Jaafar, Z. A., Kieft, J. S. Viral RNA structure-based strategies to manipulate translation. Nature Reviews Microbiology. 17 (2), 110-123 (2019).
  6. Eswarappa, S. M., et al. Programmed translational readthrough generates antiangiogenic VEGF-Ax. Cell. 157 (7), 1605-1618 (2014).
  7. Rodnina, M. V., et al. Translational recoding: canonical translation mechanisms reinterpreted. Nucleic Acids Research. 48 (3), 1056-1067 (2020).
  8. Li, Y., et al. Transactivation of programmed ribosomal frameshifting by a viral protein. Proceedings of the National Academy of Sciences. 111 (21), 2172 (2014).
  9. Napthine, S., et al. Protein-directed ribosomal frameshifting temporally regulates gene expression. Nature Communications. 8 (1), 15582 (2017).
  10. Patel, A., et al. Molecular characterization of the RNA-protein complex directing -2/-1 programmed ribosomal frameshifting during arterivirus replicase expression. Journal of Biological Chemistry. 295 (52), 17904-17921 (2020).
  11. Napthine, S., Bell, S., Hill, C. H., Brierley, I., Firth, A. E. Characterization of the stimulators of protein-directed ribosomal frameshifting in Theiler’s murine encephalomyelitis virus. Nucleic Acids Research. 47 (15), 8207-8223 (2019).
  12. Marshall, R. A., Aitken, C. E., Dorywalska, M., Puglisi, J. D. Translation at the Single-Molecule Level. Annual Review of Biochemistry. 77 (1), 177-203 (2008).
  13. Rodnina, M. V. The ribosome in action: Tuning of translational efficiency and protein folding. Protein science : A publication of the Protein Society. 25 (8), 1390-1406 (2016).
  14. Rodnina, M. V., Fischer, N., Maracci, C., Stark, H. Ribosome dynamics during decoding. Philosophical Transactions of Royal Society of London B Biological Sciences. 372 (1716), (2017).
  15. Yan, S., Wen, J. D., Bustamante, C., Tinoco, I. Ribosome excursions during mRNA translocation mediate broad branching of frameshift pathways. Cell. 160 (5), 870-881 (2015).
  16. Liu, T., et al. Direct measurement of the mechanical work during translocation by the ribosome. eLife. 3, 03406 (2014).
  17. Desai, V. P., et al. Co-temporal force and fluorescence measurements reveal a ribosomal gear shift mechanism of translation regulation by structured mRNAs. Molecular Cell. 75 (5), 1007-1019 (2019).
  18. Choi, J., O’Loughlin, S., Atkins, J. F., Puglisi, J. D. The energy landscape of -1 ribosomal frameshifting. Science Advances. 6 (1), (2020).
  19. Prabhakar, A., Puglisi, E. V., Puglisi, J. D. Single-molecule fluorescence applied to translation. Cold Spring Harbor Perspectives in Biology. 11 (1), 032714 (2019).
  20. Bao, C., et al. mRNA stem-loops can pause the ribosome by hindering A-site tRNA binding. Elife. 9, 55799 (2020).
  21. Chen, J., Tsai, A., O’Leary, S. E., Petrov, A., Puglisi, J. D. Unraveling the dynamics of ribosome translocation. Current Opinion in Structural Biology. 22 (6), 804-814 (2012).
  22. Qu, X., et al. The ribosome uses two active mechanisms to unwind messenger RNA during translation. Nature. 475 (7354), 118-121 (2011).
  23. Zheng, Q., et al. Ultra-stable organic fluorophores for single-molecule research. Chemical Society Reviews. 43 (4), 1044-1056 (2014).
  24. Blanchard, S. C. Single-molecule observations of ribosome function. Current Opinion in Structural Biology. 19 (1), 103-109 (2009).
  25. Juette, M. F., et al. The bright future of single-molecule fluorescence imaging. Current Opinion in Chemical Biology. 20, 103-111 (2014).
  26. McCauley, M. J., Williams, M. C. Mechanisms of DNA binding determined in optical tweezers experiments. Biopolymers. 85 (2), 154-168 (2007).
  27. Ashkin, A., Dziedzic, J. M., Bjorkholm, J. E., Chu, S. Observation of a single-beam gradient force optical trap for dielectric particles. Optics Letters. 11 (5), 288-290 (1986).
  28. Bustamante, C., Smith, S. B., Liphardt, J., Smith, D. Single-molecule studies of DNA mechanics. Current Opinion in Structural Biology. 10 (3), 279-285 (2000).
  29. Choudhary, D., Mossa, A., Jadhav, M., Cecconi, C. Bio-molecular applications of recent developments in optical tweezers. Biomolecules. 9 (1), 23 (2019).
  30. Moffitt, J. R., Chemla, Y. R., Smith, S. B., Bustamante, C. Recent advances in optical tweezers. Annual Reviews of Biochemistry. 77, 205-228 (2008).
  31. Li, P. T. X., Vieregg, J., Tinoco, I. How RNA Unfolds and Refolds. Annual Review of Biochemistry. 77 (1), 77-100 (2008).
  32. Stephenson, W., Wan, G., Tenenbaum, S. A., Li, P. T. Nanomanipulation of single RNA molecules by optical tweezers. Journal of Visualized Experiments. (90), e51542 (2014).
  33. Halma, M. T. J., Ritchie, D. B., Cappellano, T. R., Neupane, K., Woodside, M. T. Complex dynamics under tension in a high-efficiency frameshift stimulatory structure. Proceedings of the National Academy of Sciences. 116 (39), 19500 (2019).
  34. Hansen, T. M., Reihani, S. N. S., Oddershede, L. B., Sørensen, M. A. Correlation between mechanical strength of messenger RNA pseudoknots and ribosomal frameshifting. Proceedings of the National Academy of Sciences of the United States of America. 104 (14), 5830-5835 (2007).
  35. Zhong, Z., et al. Mechanical unfolding kinetics of the SRV-1 gag-pro mRNA pseudoknot: possible implications for -1 ribosomal frameshifting stimulation. Science Reports. 6, 39549 (2016).
  36. McCauley, M. J., Rouzina, I., Li, J., Núñez, M. E., Williams, M. C. Significant differences in RNA structure destabilization by HIV-1 GagDp6 and NCp7 proteins. Viruses. 12 (5), 484 (2020).
  37. de Messieres, M., et al. Single-molecule measurements of the CCR5 mRNA unfolding pathways. Biophysics Journal. 106 (1), 244-252 (2014).
  38. Yang, L., et al. Single-molecule mechanical folding and unfolding of RNA hairpins: Effects of single A-U to A·C pair substitutions and single proton binding and implications for mRNA structure-induced -1 ribosomal frameshifting. Journal of American Chemical Society. 140 (26), 8172-8184 (2018).
  39. McCauley, M. J., et al. Targeted binding of nucleocapsid protein transforms the folding landscape of HIV-1 TAR RNA. Proceedings of the National Academy of Sciences of the United States of America. 112 (44), 13555-13560 (2015).
  40. Whitley, K. D., Comstock, M. J., Chemla, Y. R. High-resolution "Fleezers": Dual-trap optical tweezers combined with single-molecule fluorescence detection. Methods in Molecular Biology. 1486, 183-256 (2017).
  41. Yerramilli, V. S., Kim, K. H. Labeling RNAs in live cells using malachite green aptamer scaffolds as fluorescent probes. ACS Synthetic Biology. 7 (3), 758-766 (2018).
  42. Gross, P., Farge, G., Peterman, E. J., Wuite, G. J. Combining optical tweezers, single-molecule fluorescence microscopy, and microfluidics for studies of DNA-protein interactions. Methods in Enzymology. 475, 427-453 (2010).
  43. Zimmer, M. M., et al. The short isoform of the host antiviral protein ZAP acts as an inhibitor of SARS-CoV-2 programmed ribosomal frameshifting. Nature Communications. 12 (1), 7193 (2021).
  44. Neupane, K., Yu, H., Foster, D. A. N., Wang, F., Woodside, M. T. Single-molecule force spectroscopy of the add adenine riboswitch relates folding to regulatory mechanism. Nucleic acids research. 39 (17), 7677-7687 (2011).
  45. Ritchie, D. B., Soong, J., Sikkema, W. K., Woodside, M. T. Anti-frameshifting ligand reduces the conformational plasticity of the SARS virus pseudoknot. Journal of the American Chemical Society. 136 (6), 2196-2199 (2014).
  46. Janissen, R., et al. Invincible DNA tethers: covalent DNA anchoring for enhanced temporal and force stability in magnetic tweezers experiments. Nucleic Acids Research. 42 (18), 137 (2014).
  47. Smith, S. B., Cui, Y., Bustamante, C. Overstretching B-DNA: The elastic response of individual double-stranded and single-stranded DNA molecules. Science. 271 (5250), 795 (1996).
  48. Puljung, M. C., Zagotta, W. N. Labeling of specific cysteines in proteins using reversible metal protection. Biophysical Journal. 100 (10), 2513-2521 (2011).
  49. Toseland, C. P. Fluorescent labeling and modification of proteins. Journal of Chemical Biology. 6 (3), 85-95 (2013).
  50. Hill, C. H., et al. Structural and molecular basis for Cardiovirus 2A protein as a viral gene expression switch. Nature Communications. 12 (1), 7166 (2021).
  51. Butterworth, S. On the theory of filter amplifiers. Experimental Wireless and the Wireless Engineer. 7, 536-541 (1930).
  52. Wang, M. D., Yin, H., Landick, R., Gelles, J., Block, S. M. Stretching DNA with optical tweezers. Biophysics Journal. 72 (3), 1335-1346 (1997).
  53. Mukhortava, A., et al. Structural heterogeneity of attC integron recombination sites revealed by optical tweezers. Nucleic Acids Research. 47 (4), 1861-1870 (2019).
  54. Buck, S., Pekarek, L., Caliskan, N. POTATO: An automated pipeline for batch analysis of optical tweezers data. bioRxiv. , (2021).
  55. Zhang, Y., Jiao, J., Rebane, A. A. Hidden Markov modeling with detailed balance and its application to single protein folding. Biophysical Journal. 111 (10), 2110-2124 (2016).
  56. Sgouralis, I., Pressé, S. An introduction to infinite HMMs for single-molecule data analysis. Biophysics Journal. 112 (10), 2021-2029 (2017).
  57. Müllner, F. E., Syed, S., Selvin, P. R., Sigworth, F. J. Improved hidden Markov models for molecular motors, part 1: basic theory. Biophysical Journal. 99 (11), 3684-3695 (2010).
  58. Elms, P. J., Chodera, J. D., Bustamante, C. J., Marqusee, S. Limitations of constant-force-feedback experiments. Biophysical Journal. 103 (7), 1490-1499 (2012).
  59. Re, A., Joshi, T., Kulberkyte, E., Morris, Q., Workman, C. T. RNA-protein interactions: an overview. Methods Molecular Biology. 1097, 491-521 (2014).
  60. Jankowsky, E., Harris, M. E. Specificity and nonspecificity in RNA-protein interactions. Nature reviews. Molecular Cell Biology. 16 (9), 533-544 (2015).
  61. Lim, F., Peabody, D. S. RNA recognition site of PP7 coat protein. Nucleic Acids Research. 30 (19), 4138-4144 (2002).
  62. Sunbul, M., Jäschke, A. SRB-2: a promiscuous rainbow aptamer for live-cell RNA imaging. Nucleic Acids Research. 46 (18), 110 (2018).
  63. Sanchez de Groot, N., et al. RNA structure drives interaction with proteins. Nature Communications. 10 (1), 3246 (2019).
  64. Zeffman, A., Hassard, S., Varani, G., Lever, A. The major HIV-1 packaging signal is an extended bulged stem loop whose structure is altered on interaction with the Gag polyprotein. Journal of Molecular Biology. 297 (4), 877-893 (2000).
  65. Mangeol, P., et al. Probing ribosomal protein-RNA interactions with an external force. Proceedings of the National Academy of Sciences. 108 (45), 18272 (2011).
  66. Luo, X., et al. Molecular mechanism of RNA recognition by Zinc-Finger antiviral protein. Cell Reports. 30 (1), 46-52 (2020).
  67. Qu, X., Lancaster, L., Noller, H. F., Bustamante, C., Tinoco, I. Ribosomal protein S1 unwinds double-stranded RNA in multiple steps. Proceedings of the National Academy of Science U. S. A. 109 (36), 14458-14463 (2012).
  68. Chandra, V., Hannan, Z., Xu, H., Mandal, M. Single-molecule analysis reveals multi-state folding of a guanine riboswitch. Nature Chemical Biology. 13 (2), 194-201 (2017).
  69. Savinov, A., Perez, C. F., Block, S. M. Single-molecule studies of riboswitch folding. Biochimica et Biophysica Acta. 1839 (10), 1030-1045 (2014).
  70. Kelly, J. A., et al. Structural and functional conservation of the programmed ribosomal frameshift signal of SARS coronavirus 2 (SARS-CoV-2). Journal of Biological Chemistry. 295 (31), 10741-10748 (2020).
  71. Neupane, K., et al. Structural dynamics of single SARS-CoV-2 pseudoknot molecules reveal topologically distinct conformers. Nature Communications. 12 (1), 4749 (2021).
  72. Schindelin, J., et al. Fiji: an open-source platform for biological-image analysis. Nature Methods. 9 (7), 676-682 (2012).
  73. Zheng, Q., Jockusch, S., Zhou, Z., Blanchard, S. C. The contribution of reactive oxygen species to the photobleaching of organic fluorophores. Photochemistry and Photobiology. 90 (2), 448-454 (2014).
  74. Deerinck, T. J. The application of fluorescent quantum dots to confocal, multiphoton, and electron microscopic imaging. Toxicologic Pathology. 36 (1), 112-116 (2008).
  75. Rill, N., Mukhortava, A., Lorenz, S., Tessmer, I. Alkyltransferase-like protein clusters scan DNA rapidly over long distances and recruit NER to alkyl-DNA lesions. Proceedings of the National Academy of Science U. S. A. 117 (17), 9318-9328 (2020).
  76. Swoboda, M., et al. Enzymatic oxygen scavenging for photostability without pH drop in single-molecule experiments. ACS Nano. 6 (7), 6364-6369 (2012).
  77. Aitken, C. E., Marshall, R. A., Puglisi, J. D. An oxygen scavenging system for improvement of dye stability in single-molecule fluorescence experiments. Biophysical Journal. 94 (5), 1826-1835 (2008).
  78. Wen, J. -. D., et al. Force unfolding kinetics of RNA using optical tweezers. I. Effects of experimental variables on measured results. Biophysical journal. 92 (9), 2996-3009 (2007).

Tags

Optical TweezersRNA-protein InteractionsTranslation RegulationSingle Molecule TechniquesFluorescence Assisted Optical TweezersForce-ramp ExperimentsConstant Force MeasurementsReal-time VisualizationDNA-RNA ConstructIn-vitro TranscriptionPCR Reactions

Play Video
PDF
DOI
DOWNLOAD MATERIALS LIST
Cite This Article
Pekarek, L., Buck, S., Caliskan, N. Optical Tweezers to Study RNA-Protein Interactions in Translation Regulation. J. Vis. Exp. (180), e62589, doi:10.3791/62589 (2022).
Download Citation
Reprints and Permissions

View Video

✖

To prove you're not a robot, please enter the text in the image below

CAPTCHA Image
Play CAPTCHA Audio
Refresh Image