Zeer efficiënte transfectie van primaire macrofagen met in vitro getranscribeerd mRNA
Summary
Macrofagen, vooral primaire macrofagen, zijn uitdagend om te transfect als ze gespecialiseerd zijn in het opsporen van moleculen van niet-eigen oorsprong. We beschrijven een protocol dat een zeer efficiënte transfectie van primaire macrofagen mogelijk maakt met mRNA gegenereerd uit DNA-templates zoals plasmiden.
Abstract
Macrofagen zijn fagocytische cellen gespecialiseerd in het opsporen van moleculen van niet-eigen oorsprong. Daartoe zijn ze uitgerust met een groot aantal patroon herkennings receptoren (PRRs). Helaas maakt dit ook macrofagen bijzonder uitdagend om te transfect als het transfectie-reagens en de getransfuneerde nucleïnezuren vaak worden herkend door de PRRS als niet-zelf. Daarom resulteert transfectie vaak in macrofaag activatie en afbraak van de getransfunde nucleïnezuren of zelfs bij zelfmoord op de macrofagen. Hier beschrijven we een protocol dat een zeer efficiënte transfectie van Murine primaire macrofagen zoals peritoneale macrofagen (PM) en met beenmerg afgeleide macrofagen (BMDM) mogelijk maakt met mRNA in vitro getranscribeerd uit DNA-templates zoals plasmiden. Met dit eenvoudige protocol worden transfectie percentages van ongeveer 50-65% voor PM en ongeveer 85% voor BMDM bereikt zonder cytotoxiciteit of immunogeniciteit waargenomen. We beschrijven in detail de generatie van mRNA voor transfectie van DNA-constructies zoals plasmiden en de transfectie-procedure.
Introduction
Macrofagen zijn fagocytische cellen die gespecialiseerd zijn in het opsporen, inname en vernederende microben, apoptotische cellen en cellulair puin. Bovendien, ze helpen om het orthese van immuunresponsen door het afscheidende cytokines en chemokines en door het presenteren van antigenen aan T-cellen en B-cellen. Macrofagen spelen ook belangrijke rollen in tal van andere processen, zoals wondgenezing, atherosclerose, tumorvorming en obesitas.
Om niet-zelf moleculen zoals pathogeen-geassocieerde moleculaire patronen (PAMPs) en out-of-place moleculen zoals schade-geassocieerde moleculaire patronen (DAMPs) te kunnen detecteren, zijn macrofagen uitgerust met een groot aantal patroon herkennings receptoren (PRR)1. Helaas maakt dit ook macrofagen bijzonder uitdagend voor transfect2 , omdat de transfectie-reagens 3 en de geoverde nucleïnezuren4,5,6,7 vaak door de PRRS worden herkend als niet-zelf. Om deze reden, transfectie van macrofagen met behulp van chemische of fysische methoden8 resulteert meestal in macrofaag activering en afbraak van de getransfuneerde nucleïnezuren of zelfs in macrofaag zelfmoord via pyroptosis, een vorm van geprogrammeerde lytische celdood geactiveerd na herkenning van cytosolische pamps/DAMPS zoals DNA of buitenlandse RNA9. Biologische transfectie van macrofagen met behulp van virussen zoals adenovirussen of lentivirussen als vectoren is vaak efficiënter, maar de bouw van dergelijke virale vectoren is tijdrovend en vereist bioveiligheid niveau 2-apparatuur10,11.
Dus, hoewel macrofagen het onderwerp zijn van intensief onderzoek, wordt de analyse van hun functies op moleculair niveau belemmerd, omdat een van de belangrijkste instrumenten van moleculaire biologie, de transfectie van nucleïnezuur constructies voor exogene expressie van eiwitten, is nauwelijks toepasbaar. Dit dwingt onderzoekers vaak macrofaag-achtige cellijnen te gebruiken in plaats van bonafide macrofagen. Toepassingen voor nucleïnezuur construct trans fectie omvatten expressie van gemuleerde of gelabelde eiwit versies, overexpressie van een specifiek eiwit, eiwit re-expressie in een respectieve Knockout achtergrond en expressie van eiwitten van andere soorten (bijv. , CRE of of leid RNA en Cas9 voor gerichte genen knock-out).
Hier beschrijven we een protocol dat zeer efficiënte transfectie van (meestal moeilijk te transfect) primaire macrofagen toestaat, dat is Murine peritoneale macrofagen (PM) en met beenmerg afgeleide macrofagen (BMDM) met mRNA gegenereerd uit DNA-sjablonen zoals plasmiden. Belangrijk is dat de in vitro getranscribeerde mRNA die met dit protocol is gegenereerd, de natuurlijk voorkomende gemodificeerde nucleosiden 5-methyl-CtP en pseudo-UTP bevat die de immunogeniciteit verminderen en de stabiliteit verhogen4,6,7,12,13. Bovendien worden de 5 ‘-uiteinden van de in vitro getranscribeerde mRNA gedefosforyleerd door Antarctische fosfatase om herkenning door de Rig-I complex14,15te voorkomen. Dit minimaliseert de aangeboren immuunherkenning van de in vitro getranscribeerd mRNA. Met ons eenvoudig uit te voeren protocol worden transfectie percentages tussen 50-65% (peritoneale macrofagen (PM)) en 85% (BMDM) bereikt terwijl, belangrijker nog, er geen cytotoxiciteit of immunogeniciteit is waargenomen. We beschrijven in detail (i) hoe de immunologisch gesilenced mRNA voor Transfectie kan worden gegenereerd uit DNA-constructies zoals plasmiden en (II) de transfectie procedure zelf.
Protocol
Representative Results
Discussion
Hier presenteren we een protocol voor zeer efficiënte transfectie van meestal moeilijk te transfect primaire macrofagen met in vitro getranscribeerd mRNA. Belangrijk is dat de transfectie van de macrofagen met behulp van dit protocol geen celdood induceert of proinflammatoire signalering activeert die aangeeft dat noch het transfectiereagens noch de getransfunteerde mRNA als niet-zelf worden herkend.
De kwaliteit van de mRNA is van cruciaal belang voor een succesvolle transfectie van macrofag…
Disclosures
The authors have nothing to disclose.
Acknowledgements
Dit werk werd gesteund door de Deutsche Forschungsgemeinschaft (SFB 670).
Materials
| 5-methyl-CTP (100 mM) | Jena Biosience | NU-1138S | stored at -20 °C |
| Antarctic phosphatase | New England BioLabs | M0289 | stored at -20 °C |
| Antarctic phosphatase reaction buffer (10X) | New England BioLabs | B0289 | stored at -20 °C |
| anti-NEMO/IKKγ antibody | Invitrogen | MA1-41046 | stored at -20 °C |
| anti-β-actin antibody | Sigma-Aldrich | A2228 | stored at -20 °C |
| Petri dishes 92,16 mm with cams | Sarstedt | 821,473 | stored at RT |
| CD11b Microbeads mouse and human | Miltenyi Biotec | 130-049-601 | stored at 4 °C |
| Cre recombinase + T7-Promotor forward primer | Sigma-Aldrich | 5′-GAAATTAATACGACTCACTATA GGGGCAGCCGCCACCATGTCC AATTTACTGACCGTAC-3´, stored at -20 °C |
|
| Cre recombinase + T7-Promotor reverse primer | Sigma-Aldrich | 5′-CTAATCGCCATCTTCCAGCAGG C-3′, stored at -20 °C |
|
| DNA purification kit: QIAquick PCR purification Kit | Qiagen | 28104 | stored at RT |
| eGFP + T7-Promotor forward primer | Sigma-Aldrich | 5´-GAAATTAATACGACTCACTATA GGGATCCATCGCCACCATGGTG AGCAAGG-3´, stored at -20 °C |
|
| eGFP + T7-Promotor reverse primer | Sigma-Aldrich | 5´-TGGTATGGCTGATTA TGATCTAGAGTCG-3´, stored at -20 °C |
|
| Fast Digest buffer (10X) | Thermo Scientific | B64 | stored at -20 °C |
| FastDigest XbaI | Thermo Scientific | FD0684 | stored at -20 °C |
| high-fidelity polymerase with proofreading: Q5 High-Fidelity DNA-Polymerase | New England Biolabs Inc | M0491S | stored at -20 °C |
| IKKβ + T7-Promotor forward primer | Sigma-Aldrich | 5′-GAAATTAATACGACTCACTATA GGGTTGATCTACCATGGACTACA AAGACG-3′, stored at -20 °C |
|
| IKKβ + T7-Promotor reverse primer | Sigma-Aldrich | 5′-GAGGAAGCGAGAGCT-CCATCTG-3′, stored at -20 °C | |
| in vitro mRNA transcription kit: HiScribe T7 ARCA mRNA kit (with polyA tailing) | New England BioLabs | E2060 | stored at -20 °C |
| LS Columns | Miltenyi Biotec | 130-042-401 | stored at RT |
| MACS MultiStand | Miltenyi Biotec | 130-042-303 | stored at RT |
| mRNA transfection buffer and reagent: jetMESSENGER | Polyplus transfection | 409-0001DE | stored at 4 °C |
| Mutant IKKβ IKK-2S177/181E plasmid | Addgene | 11105 | stored at -20 °C |
| Mutant NEMOC54/347A plasmid | Addgene | 27268 | stored at -20 °C |
| pEGFP-N3 plasmid | Addgene | 62043 | stored at -20 °C |
| poly(I:C) | Calbiochem | 528906 | stored at -20 °C |
| pPGK-Cre plasmid | F. T. Wunderlich, H. Wildner, K. Rajewsky, F. Edenhofer, New variants of inducible Cre recombinase: A novel mutant of Cre-PR fusion protein exhibits enhanced sensitivity and an expanded range of inducibility. Nucleic Acids Res. 29, 47e (2001). stored at -20 °C | ||
| pseudo-UTP (100 mM) | Jena Biosience | NU-1139S | stored at -20 °C |
| QuadroMACS Separator | Miltenyi Biotec | 130-090-976 | stored at RT |
| Rat-anti-mouse CD11b antibody, APC-conjugated | BioLegend | 101212 | stored at 4 °C |
| Rat-anti-mouse F4/80 antibody, PE-conjugated | eBioscience | 12-4801-82 | stored at 4 °C |
| recombinant M-CSF | Peprotech | 315-02 | stored at -20 °C |
| RNA purification kit: MEGAclear transcription clean-up kit | ThermoFisher Scientific | AM1908 | stored at 4 °C |
| RNAse-degrading surfactant: RnaseZAP | Sigma-Aldrich | R2020 | stored at RT |
| ultrapure LPS from E.coli O111:B4 | Invivogen | stored at -20 °C | |
| Wild type IKKβ plasmid | Addgene | 11103 | stored at -20 °C |
| Wild type NEMO plasmid | Addgene | 27268 | stored at -20 °C |
References
- Ley, K., Pramod, A. B., Croft, M., Ravichandran, K. S., Ting, J. P. How Mouse Macrophages Sense What Is Going On. Frontiers in Immunology. 7 (204), (2016).
- Zhang, X., Edwards, J. P., Mosser, D. M. The expression of exogenous genes in macrophages: obstacles and opportunities. Methods in Molecular Biolology. 531, 123-143 (2009).
- Guo, X., et al. Transfection reagent Lipofectamine triggers type I interferon signaling activation in macrophages. Immunology and cell biology. 97 (1), 92-96 (2019).
- Kariko, K., Weissman, D. Naturally occurring nucleoside modifications suppress the immunostimulatory activity of RNA: implication for therapeutic RNA development. Current Opinion in Drug Discovery and Development. 10 (5), 523-532 (2007).
- Van De Parre, T. J., Martinet, W., Schrijvers, D. M., Herman, A. G., De Meyer, G. R. mRNA but not plasmid DNA is efficiently transfected in murine J774A.1 macrophages. Biochemical and biophysical research communications. 327 (1), 356-360 (2005).
- Uchida, S., Kataoka, K., Itaka, K. Screening of mRNA Chemical Modification to Maximize Protein Expression with Reduced Immunogenicity. Pharmaceutics. 7 (3), 137-151 (2015).
- Kariko, K., et al. Incorporation of pseudouridine into mRNA yields superior nonimmunogenic vector with increased translational capacity and biological stability. Molecular Therapy. 16 (11), 1833-1840 (2008).
- Khantakova, J. N., et al. Transfection of bone marrow derived cells with immunoregulatory proteins. Cytokine. 108, 82-88 (2018).
- Franz, K. M., Kagan, J. C. Innate Immune Receptors as Competitive Determinants of Cell Fate. Molecular Cell. 66 (6), 750-760 (2017).
- Kaestner, L., Scholz, A., Lipp, P. Conceptual and technical aspects of transfection and gene delivery. Bioorganic & medicinal chemistry letters. 25 (6), 1171-1176 (2015).
- Kim, T. K., Eberwine, J. H. Mammalian cell transfection: the present and the future. Analytical and Bioanalytical Chemistry. 397 (8), 3173-3178 (2010).
- Kormann, M. S., et al. Expression of therapeutic proteins after delivery of chemically modified mRNA in mice. Nature Biotechnology. 29 (2), 154-157 (2011).
- Kariko, K., Buckstein, M., Ni, H., Weissman, D. Suppression of RNA recognition by Toll-like receptors: the impact of nucleoside modification and the evolutionary origin of RNA. Immunity. 23 (2), 165-175 (2005).
- Hornung, V., et al. 5′-Triphosphate RNA is the ligand for RIG-I. Science. 314 (5801), 994-997 (2006).
- Pichlmair, A., et al. RIG-I-mediated antiviral responses to single-stranded RNA bearing 5′-phosphates. Science. 314 (5801), 997-1001 (2006).
- Herb, M., et al. Mitochondrial reactive oxygen species enable proinflammatory signaling through disulfide linkage of NEMO. Science Signaling. 12 (568), (2019).
- Schmidt-Supprian, M., et al. NEMO/IKK gamma-deficient mice model incontinentia pigmenti. Molecular Cell. 5 (6), 981-992 (2000).
- Mandal, P. K., Rossi, D. J. Reprogramming human fibroblasts to pluripotency using modified mRNA. Nature Protocols. 8 (3), 568-582 (2013).
- Oh, S., Kessler, J. A. Design, Assembly, Production, and Transfection of Synthetic Modified mRNA. Methods. 133, 29-43 (2018).
