דור, הגברה, טיטור של Recombinant וירוסים Syncytial הנשימה
Summary
אנו מתארים שיטה ליצירת, הגברה גנטית שונה וירוסים syncytial הנשימה (RSVs) ואת וזמינותו של פלאק ממוטב עבור RSVs. אנו ממחישים לפרוטוקול זה על-ידי יצירת שני וירוסים רקומביננטי בהתאמה לאפשר כימות של שכפול RSV ולחיות ניתוח של RSV הכללה וגופי בגרגרים הכללה גופים הקשורים דינמיקה.
Abstract
השימוש של וירוסים רקומביננטי הפך מכריע וירולוגיה בסיסי או מוחלת. גנטיקה הפוכה הוכח להיות טכנולוגיה רבת עוצמה, הן כדי לפענח את שכפול ויראלי מנגנונים כדי ללמוד antivirals או לספק פלטפורמת פיתוח חיסונים. הבנייה ואת מניפולציה של מערכת גנטית הפוך שלילי-בשרך וירוס רנ א כגון וירוס syncytial במערכת הנשימה (RSV), עם זאת, נותר עדין ודורש ידע מיוחד. הגנום RSV הוא RNA חד גדילי חוטים, שלילי-תחושה של בערך 15 kb המשמש כתבנית עבור נגיפי RNA שכפול והן שעתוק. מערכת הפוכה הגנטיקה שלנו משתמש עותק cDNA של הגנום הארוך זן RSV האנושי (HRSV). CDNA הזה, כמו גם cDNAs קידוד חלבונים ויראלי של פולימראז מורכבות (L, P, N, M2-1), מוצבים ביטוי בודדים וקטורים תחת רצפי בקרה פולימראז T7. תרביות תאים של רכיבים אלה בסר-T7/5 תאים, אשר stably אקספרס T7 פולימראז, מאפשר שכפול cytoplasmic שעתוק של RSV רקומביננטי, והוליד virions מהונדסים. RSV חדש, אשר קיים על פני התא, את תגובת שיקוע של התרבות של BSRT7/5, נאסף להדביק תאים אנושיים HEp-2 עבור נגיפים. שניים או שלושה סיבובים של הגברה נדרשים לרכוש מניות נגיפית המכילה 1 x 106 עונה 1 פרק 107 ויוצרים רובד יחידות (PFU) / mL. שיטות האופטימלי קציר, הקפאה, ו טיטור של מניות ויראלי מתוארים כאן בפירוט. אנחנו המחשת פרוטוקול המובאת כאן על-ידי יצירת שני וירוסים רקומביננטי בהתאמה לבטא חינם חלבון פלואורסצנטי ירוק (GFP) (RSV-GFP) או ויראלי M2-1 דבוקה GFP (RSV-M2-1-GFP). אנו מראים כיצד להשתמש RSV-GFP כדי לכמת את RSV-M2-1-GFP להמחיש מבנים ויראלי, כמו גם חלבון נגיפי דינאמיקה של תאים חיים, באמצעות טכניקות במיקרוסקופ וידאו ושכפול RSV.
Introduction
האדם RSV הוא הגורם המוביל של אשפוז לדלקת חריפה בדרכי הנשימה תינוקות ברחבי העולם1. בנוסף, RSV משויכת נטל משמעותי במחלה אצל מבוגרים להשוות שפעת, עם רוב אשפוז, התמותה נטל הקשישים2. אין חיסונים או antivirals ספציפיים זמינים עדיין נגד RSV, אבל מבטיח תרופות חדשות הן פיתוח3,4. את המורכבות ואת הכובד של הטכניקות של כימות של כפל RSV לעכב את החיפוש אחר antivirals או חיסונים למרות מאמצים ניכרים הנוכחי. כימות של RSV כפל במבחנה בדרך כלל מבוסס על שיטות מפרך, גוזלת זמן, יקר, אשר מורכב בעיקר בניתוח אפקט ציטופתי על ידי מיקרוסקופ, immunostaining, הפחתת פלאק מבחני, כמותי רוורס טרנסקריפטאז (לרביעיית)-תגובת שרשרת פולימראזית (PCR), והוא מקושר-אנזים immunosorbent assay בדיקות. וירוסים עם הגנום ששונה ולבטא גנים הכתב, כגון אלה קידוד ה-GFP, מתאימים יותר עבור הקרנות כאלה. מצמידים בשימוש בקוראי צלחת אוטומטיות, נושא גן וירוסים רקומביננטי כתב יכול לעשות מבחני אלה מתאימים יותר למטרות התקינה ו תפוקה גבוהה.
RSV הוא מעטפת, nonsegmented שלילי-סנס וירוס רנ א שייך הסוג של Orthopneumovirus של Pneumoviridae משפחה, סדר Mononegavirales5. הגנום RSV הוא RNA חד גדילי חוטים, שלילי-תחושה של בערך 15 kb, אשר מכיל את אזור noncoding ב הגפיים 3′ ו 5′ שנקרא מנהיג, הקרוואן, 10 יחידות תעתיק קידוד חלבונים 11. הגנים מסודרים כדלקמן: 3′-NS1, NS2, N, P, M, SH, G, F, M2 (קידוד חלבונים M2-1 ו- M2-2), L-5′. ה-RNA הגנומי נארז בחוזקה על ידי נוקלאופרוטאין שימוש ש RNA הגנומי encapsidated כתבנית, תלויי-RNA נגיפי RNA פולימראז (RdRp) יבטיח שעתוק ושכפול של RNA נגיפי. RdRp ויראלי מורכב של החלבון גדולה L אשר נושאת את פעילות נוקלאוטיד פולימראז כשלעצמה, שלה קופקטור חובה phosphoprotein P והחלבון M2-1, אשר מתפקד בתור תעתיק ויראלי גורם6. תאים נגועים, RSV גורם להיווצרות של הכללות cytoplasmic נקרא הכללה גופים (IBs). תכלילים cytoplasmic מורפולוגית דומים נצפו9,8,7, Mononegaviralesמספר10. מחקרים שנעשו לאחרונה על נגיף הכלבת, vesicular stomatitis וירוס (VSV), אבולה וירוס RSV הראה כי סינתזה RNA נגיפי מתרחשת ב- IBs, אשר יכול להיחשב ובכך מפעלים ויראלי8,9,11, 12. המפעלים וירוס להתרכז RNA וחלבונים ויראלי נדרש סינתזה RNA נגיפי, מכילים גם חלבונים הסלולרית13,14,15,16, 17. IBs התערוכה של subcompartment תפקודית שנקרא בגרגרים הקשורים ליברות (IBAGs), אשר רכזו החדש synthetized המתהווה mRNA הנגיפי יחד עם החלבון M2-1. RNA הגנומי של L, P, ואת N לא מזוהים ב- IBAGs. IBAGs הם מבנים כדוריים דינמי קטן בתוך המעי הרגיז כי התערוכה את המאפיינים של organelles נוזלי12. למרות התפקיד המרכזי של IBs בכפל נגיפית, מעט מאוד ידוע על הטבע, המבנה הפנימי, היווצרות, הפעולה של המפעלים האלה ויראלי.
הביטוי של הגנום של poliovirus מ cDNA אפשרה הייצור של השיבוט ויראלי זיהומיות הראשון בשנת 198118. חד-גדילי RNA שלילי וירוסים, זה לא היה עד 1994 הייצור של וירוס הכלבת הראשון בעקבות תקנים של פלסמידים לתוך תאים19 התרחש. מבוסס על פלסמיד הפוכה גנטי המערכת הראשונה עבור RSV פורסם בשנת 199520. גנטיקה הפוכה הובילו התקדמות גדולה בתחום של וירולוגיה. האפשרות של הצגת שינויים ספציפיים לתוך הגנום הנגיפי סיפקה קריטי תובנות שכפול ועל בפתוגנזה של וירוסי RNA. טכנולוגיה זו הנחתה במידה רבה גם את ההתפתחות של חיסונים בכך שהוא מאפשר הנחתה ספציפי באמצעות סדרת יישוב של שינויים. שינויים הגנום ומאפשר כימות מהירה של כפל נגיפית במידה רבה משופרים את ההקרנה אנטי ויראליים, חקר את מצב הפעולה.
למרות שתואר קודם לכן, קבלת RSVs מהונדסים נשאר עדין. כאן, אנו מפרטים פרוטוקול כדי ליצור שני סוגים של HRSV רקומביננטי, בהתאמה לבטא RSV-GFP או RSV-M2-1-GFP. ב פרוטוקול זה, אנו מתארים את התנאים תרביות תאים הנחוצים כדי להציל רקומביננטי וירוסים חדשים, כמו גם הגברה שלהם כדי לקבל מניות ויראלי עם כייל נוגדנים גבוה, מתאים experimentations לשחזור. הבנייה של וקטורים של הגנטיקה הפוכה כשלעצמה לא מתואר כאן. אנו מתארים שיטות קציר אופטימלית, הקפאה של מניות ויראלי. השיטה המדויקת ביותר לכמת נגיפים זיהומיות נשאר פלאק וזמינותו. תאים נגועים דילולים טורי של ההשעיה שנותחה, מודגרות עם כיסוי האוסרת פעפוע של חלקיקים נגיפיים חינם ב- תגובת שיקוע. בתנאים כאלה, רק ידביק הווירוס תאים רציפים ויוצרים “שלט” עבור כל חלקיק זיהומיות הראשונית. ב RSV טיטור וזמינותו קונבנציונאלי, שלטי התגלה על ידי immunostaining, ספרתי בהסתכלות מיקרוסקופית. שיטה זו היא יקרים ולגזול. כאן אנחנו תיאר פרוטוקול פשוט מאוד עבור assay רובד RSV באמצעות כיסוי שעוות תאית המאפשרת היווצרות הפלאק גלוי לעין בלתי מזוינת. אנחנו מראים כיצד ניתן להשתמש RSV-GFP כדי למדוד RSV שכפול וכדי, לפיכך, לכמת את ההשפעה בשווי. שילוב של גנטיקה הפוכה וטכנולוגיה הדמיה בשידור חי, נדגים כיצד RSV-M2-1-GFP מאפשרות למדענים להמחיש M2-1 בתאים חיים, לעקוב אחר הדינמיקה של מבנים תאיים ויראלי, כגון תסמונת המעי הרגיז.
Protocol
Representative Results
Discussion
כאן אנו מציגים שיטת החילוץ של רקומביננטי RSVs מ 5 פלסמידים, הגברה שלהם. היכולת לתמרן את הגנום של וירוסים יש מהפכה וירולוגיה המחקר לבדוק מוטציות, מבטאים גנים נוספים או חלבון נגיפי מתויגות. RSV יש תיאר ואנו לשמש דוגמא במאמר זה הוא וירוס לבטא גן כתב את RSV-GFP (לא פורסם), מבטא החלבון M2-1 דבוקה תג ה-GFP<sup cla…
Disclosures
The authors have nothing to disclose.
Acknowledgements
המחברים מודים ד ר צ’ין יו של חברת AstraZeneca R & D בוסטון, מסצ’וסטס, ארה ב, על מתן התרופה AZD4316. המחברים מודים פלטפורמת Cymages לגישה אל המיקרוסקופ ScanR האולימפוס, אשר נתמכה על ידי מעניק מאזור ile-de-(בריאות אחד עמום). המחברים להכיר תמיכה את INSERM ואוניברסיטת סן ורסאי.
Materials
| 35mm µ dish for live cell imaging | Ibidi | 81156 | |
| A549 | ATCC | ATCC CCL-185 | |
| Avicel RC-591 | FMC BioPolymer | Avicel RC-591 | Technical and other information on Avicels is available at http://www.fmcbiopolymer.com. Store at room temperature. Protocol in step 4 is optimized for this reagent. |
| BSRT7/5 | not commercially available | See ref 22. Buchholz et al, 1999 | |
| Crystal violet solution | Sigma | HT90132 | |
| Fluorescence microscope for observations | Olympus | IX73 Olympus microscope | |
| Fluorescence microscope for videomicroscopy | Olympus | ScanR Olympus microscope | |
| HEp-2 | ATCC | ATCC CCL-23 | |
| HEPES ≥99.5% | Sigma | H3375 | |
| L-Glutamine (200 mM) | ThermoFisher Scientific | 25030024 | |
| LIPOFECTAMINE 2000 REAGENT | ThermoFisher Scientific | 11668019 | Protocol in step 2.3. is optimized for this reagent. |
| MEM (10X), no glutamine | ThermoFisher Scientific | 11430030 | |
| MEM, GlutaMAX Supplement | ThermoFisher Scientific | 41090-028 | |
| MgSO4 ReagentPlus, ≥99.5% | Sigma | M7506 | |
| Opti-MEM I Reduced Serum Medium | ThermoFisher Scientific | 51985-026 | |
| Paraformaldehyde Aqueous Solution, 32%, EM Grade | Electron Microscopy Sciences | 15714 | |
| Penicillin-Streptomycin (10,000 U/mL) | ThermoFisher Scientific | 15140122 | |
| Plasmids | not commercially available | see ref 21. Rameix-Welti et al, 2014 | |
| See Saw Rocker | VWR | 444-0341 | |
| Si RNA GAPDH | Dharmacon | ON-TARGETplus siRNA D-001810-10-05 |
SMARTpool and 3 of 4 individual siRNAs designed by Dharmacon. |
| Si RNA IMPDH2 | Dharmacon | ON-TARGETplus siRNA IMPDH2 Pool- Human L-004330-00-0005 |
SMARTpool of 4 individual siRNAs designed by Dharmacon. Individual references and sequences J-004330-06: GGAAAGUUGCCCAUUGUAA; J-004330-07: GCACGGCGCUUUGGUGUUC; J-004330-08: AAGGGUCAAUCCACAAAUU; J-004330-09: GGUAUGGGUUCUCUCGAUG; |
| Si RNA RSV N | Dharmacon | ON-TARGETplus custom siRNA | UUCAGAAGAACUAGAGGCUAU and UUUCAUAAAUUCACUGGGUUA |
| SiRNA NT | Dharmacon | ON-TARGETplus Non-targeting Pool | |
| SiRNA transfection reagent | Dharmacon | DharmaFECT 1 Ref: T-2001-03 | Protocol in steps 5.1.and 5.1.2 are optimized for this reagent. |
| Sodium Bicarbonate 7.5% solution | ThermoFisher Scientific | 25080094 | |
| Spectrofluorometer | Tecan | Tecan infinite M200PRO |
References
- Shi, T., et al. Global, regional, and national disease burden estimates of acute lower respiratory infections due to respiratory syncytial virus in young children in 2015: a systematic review and modelling study. The Lancet. 390 (10098), 946-958 (2017).
- Falsey, A. R., Hennessey, P. A., Formica, M. A., Cox, C., Walsh, E. E. Respiratory Syncytial Virus Infection in Elderly and High-Risk Adults. The New England Journal of Medicine. 352 (17), 1749-1759 (2005).
- DeVincenzo, J. P., et al. Activity of Oral ALS-008176 in a Respiratory Syncytial Virus Challenge Study. The New England Journal of Medicine. 373 (21), 2048-2058 (2015).
- DeVincenzo, J. P., et al. Oral GS-5806 Activity in a Respiratory Syncytial Virus Challenge Study. The New England Journal of Medicine. 371 (8), 711-722 (2014).
- Afonso, C. L., et al. Taxonomy of the order Mononegavirales: update 2016. Archives of Virology. 161 (8), 2351-2360 (2016).
- Collins, P. L., Hill, M. G., Cristina, J., Grosfeld, H. Transcription elongation factor of respiratory syncytial virus, a nonsegmented negative-strand RNA virus. Proceedings of the National Academy of Sciences of the United States of America. 93 (1), 81-85 (1996).
- Hoenen, T., et al. Inclusion bodies are a site of ebolavirus replication. Journal of Virology. 86 (21), 11779-11788 (2012).
- Heinrich, B. S., Cureton, D. K., Rahmeh, A. A., Whelan, S. P. Protein expression redirects vesicular stomatitis virus RNA synthesis to cytoplasmic inclusions. PLoS Pathogens. 6 (6), e1000958 (2010).
- Lahaye, X., et al. Functional Characterization of Negri Bodies (NBs) in Rabies Virus-Infected Cells: Evidence that NBs Are Sites of Viral Transcription and Replication. Journal of Virology. 83 (16), 7948-7958 (2009).
- Kolesnikova, L., Mühlberger, E., Ryabchikova, E., Becker, S. Ultrastructural organization of recombinant Marburg virus nucleoprotein: comparison with Marburg virus inclusions. Journal of Virology. 74 (8), 3899-3904 (2000).
- Dolnik, O., Stevermann, L., Kolesnikova, L., Becker, S. Marburg virus inclusions: A virus-induced microcompartment and interface to multivesicular bodies and the late endosomal compartment. European Journal of Cell Biology. 94 (7-9), 323-331 (2015).
- Rincheval, V., et al. Functional organization of cytoplasmic inclusion bodies in cells infected by respiratory syncytial virus. Nature Communications. 8 (1), 563 (2017).
- Santangelo, P. J., Bao, G. Dynamics of filamentous viral RNPs prior to egress. Nucleic Acids Research. 35 (11), 3602-3611 (2007).
- Lifland, A. W., et al. Human Respiratory Syncytial Virus Nucleoprotein and Inclusion Bodies Antagonize the Innate Immune Response Mediated by MDA5 and MAVS. Journal of Virology. 86 (15), 8245-8258 (2012).
- Garcia, J., Garcia-Barreno, B., Vivo, A., Melero, J. A. Cytoplasmic inclusions of respiratory syncytial virus-infected cells: formation of inclusion bodies in transfected cells that coexpress the nucleoprotein, the phosphoprotein, and the 22K protein. Virology. 195 (1), 243-247 (1993).
- Brown, G., et al. Evidence for an association between heat shock protein 70 and the respiratory syncytial virus polymerase complex within lipid-raft membranes during virus infection. Virology. 338 (1), 69-80 (2005).
- Radhakrishnan, A., et al. Protein analysis of purified respiratory syncytial virus particles reveals an important role for heat shock protein 90 in virus particle assembly. Molecular & Cellular Proteomics. 9 (9), 1829-1848 (2010).
- Racaniello, V. R., Baltimore, D. Cloned poliovirus complementary DNA is infectious in mammalian cells. Science. 214 (4523), 916-919 (1981).
- Schnell, M. J., Mebatsion, T., Conzelmann, K. K. Infectious rabies viruses from cloned cDNA. The EMBO Journal. 13 (18), 4195-4203 (1994).
- Collins, P. L., et al. Production of infectious human respiratory syncytial virus from cloned cDNA confirms an essential role for the transcription elongation factor from the 5′ proximal open reading frame of the M2 mRNA in gene expression and provides a capability for vaccine. Proceedings of the National Academy of Sciences of the United States of America. 92 (25), 11563-11567 (1995).
- Rameix-Welti, M. -. A., et al. Visualizing the replication of respiratory syncytial virus in cells and in living mice. Nature Communications. 5, 5104 (2014).
- Buchholz, U. J., Finke, S., Conzelmann, K. K. Generation of bovine respiratory syncytial virus (BRSV) from cDNA: BRSV NS2 is not essential for virus replication in tissue culture, and the human RSV leader region acts as a functional BRSV genome promoter. Journal of Virology. 73 (1), 251-259 (1999).
- Cianci, C., Meanwell, N., Krystal, M. Antiviral activity and molecular mechanism of an orally active respiratory syncytial virus fusion inhibitor. Journal of Antimicrobial Chemotherapy. 55 (3), 289-292 (2005).
- Derscheid, R. J., et al. Human respiratory syncytial virus memphis 37 grown in HEp-2 cells causes more severe disease in lambs than virus grown in vero cells. Viruses. 5 (11), 2881-2897 (2013).
- McKimm-Breschkin, J. L. A simplified plaque assay for respiratory syncytial virus – direct visualization of plaques without immunostaining. Journal of Virological Methods. 120, 113-117 (2004).
- Matrosovich, M., Matrosovich, T., Garten, W., Klenk, D. New low-viscosity overlay medium for viral plaque assays. Virology Journal. 7, 1-7 (2006).
- Novina, C. D., Sharp, P. A. The RNAi revolution. Nature. 430 (6996), 161-164 (2004).
- Sintchak, M. D., Nimmesgern, E. The structure of inosine 5′-monophosphate dehydrogenase and the design of novel inhibitors. Immunopharmacology. 47 (2-3), 163-184 (2000).
- Beaucourt, S., Vignuzzi, M. Ribavirin: A drug active against many viruses with multiple effects on virus replication and propagation. Molecular basis of ribavirin resistance. Current Opinion in Virology. 8, 10-15 (2014).
- Hruska, J. F., Bernstein, J. M., Douglas, R. G., Hall, C. B. Effects of Ribavirin on Respiratory Syncytial Virus in vitro. Antimicrobial Agents and Chemotherapy. 17 (5), 770-775 (1980).
- Simões, E. A. F., et al. Past, Present and Future Approaches to the Prevention and Treatment of Respiratory Syncytial Virus Infection in Children. Infectious Diseases and Therapy. 7 (1), 87-120 (2018).
- Alvarez, R., et al. RNA interference-mediated silencing of the respiratory syncytial virus nucleocapsid defines a potent antiviral strategy. Antimicrobial Agents and Chemotherapy. 53 (9), 3952-3962 (2009).
- DeVincenzo, J., et al. A randomized, double-blind, placebo-comtrolled study of an RNAi-based therapy directed against respiratory syncytial virus. Proceedings of the National Academy of Sciences of the United States of America. 107 (19), 8800-8805 (2010).
- Zhou, Y., et al. High-throughput screening of a CRISPR/Cas9 library for functional genomics in human cells. Nature. 509 (7501), 487-491 (2014).
- Nikolic, J., et al. Negri bodies are viral factories with properties of liquid organelles. Nature Communications. 8 (1), 58 (2017).
