1. Digestion of DNA with Micrococcal Nuclease
2. Separation of DNA Fragments Using Polyacrylamide Gel Electrophoresis (PAGE)
3. Isolation of DNA Fragments from PAGE-gels Using the Crush and Soak Method
NOTE: This step has been adopted from Sambrook et al.11
4. End Repair of MNase-digested, Gel-purified Fragments
5. Linker Generation
NOTE: Linkers need to be amplified in parallel with section 3 to be able to proceed immediately with linker ligation. Primer sequences used below must be appropriate for the chosen gRNA expression vector. Those presented here have been designed for the vector pgRNA-pLKO.1.9 For amplification of the 5' linker from pgRNA-pLKO.1, use the primer sequences 5'-linker-F (TTGGAATCACACGACCTGGA) and 5'-linker-R (CGGTGTTTCGTCCTTTCCAC), yielding a 689 bp amplicon. For amplification of the 3' linker from pgRNA-pLKO.1, use the primers 3'-linker-F: (GTTTTAGAGCTAGAAATAGCAAGTTAAAATA) and 3'-linker-R: (ACTCGGTCATGGTAAGCTCC), which yield an 848 bp amplicon.
6. Linker Ligation and Amplification of Inserts
7. Size Selection
NOTE: This step separates MNase-fragments with the correctly attached 5' and 3' linker from fragments with two 5' or two 3' linkers based on size.
8. Cloning of PCR-amplified Fragments into the gRNA Expression Vector by Gibson Assembly
9. Preparation of Electro-competent TG1 E. coli Cells
10. Electroporation of TG1 Electrocompetent E. coli Cells
NOTE: Electroporation is one of the bottlenecks in comprehensive library generation. To preserve the library representation, it is recommended to conduct as many individual electroporation reactions as necessary/practicable and to perform the quality control steps described below (10.6. and 10.8.).
11. Extraction of Plasmid DNA
Using the protocol at hand, CORALINA gRNA libraries have been generated from human and mouse genomic DNA9 and BAC DNA (Figure 1). To produce fragments of input DNA suitable for cloning into gRNA expression vectors, optimal conditions for controlled nuclease digestion have to be determined. A typical result for the optimization of micrococcal nuclease digestion is depicted in Figure 2A. Insufficient amount of nuclease (0.1, 2, 3, 4, 4.5 or 5 units) produces no noticeable products in the required size range (10-100 bp) and 5.5-7.5 units still produced fragments that are on average too long. Larger amounts of enzyme (50 units) lead to excessive degradation of input DNA after 10 min. Consequently, an intermediate amount was chosen (10 units). The digest was scaled up to produce enough digested fragments for subsequent purification and cloning (Figure 2B). While it is recommended to blindly select DNA fragments by size and only rely on the DNA ladder for orientation to minimize exposure of DNA fragments to UV light, gels can be stained afterwards for quality control of digestion and cutting. Figure 2B shows a representative example of a PAGE gel from which DNA fragments between 20 and 30 bp have been excised. Gel purified MNase fragments were loaded onto a 20% PAGE gel to check successful size selection and purification of MNase-digested fragments (Figure 2C). The protocol at hand is compatible with the use of customized linker sequences, allowing to clone the MNase-digested fragments into gRNA expression vectors of choice. Here, gRNA-PLKO9 was used as backbone. The linkers are amplified from the gRNA expression vector using standard PCR. Figure 2D depicts a representative example of amplified linker sequences devoid of additional, incorrect or no template amplicons. Next, linker amplicons are digested with restriction enzymes to ensure linkers are ligated onto the MNase-digested fragments in the correct orientation. Figure 2D shows agarose gels of 5' and 3' linkers before and after digestion with HindIII and SacII respectively, indicating complete digestion of the linkers to the predicted 637 and 295 bp. The right-hand portion of the gel image documents the excision of the digested linker fragments. Following gel extraction of digested linkers, the next step in the protocol is the ligation of linkers to the end-repaired MNase-digested fragments. Because linker sequences are generated by PCR using unphosphorylated primers, self-ligation of linkers should not occur. Only the end-repaired MNase-digested DNA fragments provide the phosphate groups necessary for ligation. Following nick translation, the ligation product is amplified by PCR. In order to avoid excessive PCR amplification bias that could skew the representation of gRNA sequences in the library, amplification is limited to less than 20 cycles in total. Following PCR, the amplification products are difficult to visualize on agarose gels. Separate control PCRs with 32 cycles are therefore performed to detect the products (but are not used for library preparation). Results from this control PCR are shown in Figure 2E. This allows to optimize the ligation reactions and to ensure reactions are devoid of PCR artefacts, which sometimes occur in "no fragments controls" (NFC). Figure 2E shows the desired amplicon (5' linker + DNA fragment + 3' linker, length: 869 bp) following amplification of ligation reactions using equimolar (1:1) ratios between fragments and linker sequences.
Figure 1: Suggested timeline for preparing a gRNA library. CORALINA offers a simple and cost-efficient strategy for the generation of comprehensive gRNA libraries from a plethora of different DNA sources from any organism. The protocol at hand can be brought to completion during one working week. Linker generation can be performed in parallel with DNA end-repair. Preparation of electrocompetent bacteria takes two days and includes an overnight growth step and should therefore be started before assembly reactions are set up. Please click here to view a larger version of this figure.
Figure 2: Critical steps during the protocol. (A) Controlled digestion of BAC DNA enables generation of fragments of different sizes. Shown here is the optimization of MNase digestion. Purified BAC DNA was treated with different amounts of MNase for 10 min. 10 U of MNase generate DNA fragments of the desired length (20-30 bp). (B) Size selection of fragments between 20 and 30 bp using excision from polyacrylamide gels. Purified BAC DNA was treated with 10 U of MNase for 10 min. The image was recorded following excision. (C) Quality control of gel-purified fragments. After gel-purification, 1/6th of the purified MNase fragments was loaded onto a 20% PAGE gel to check successful size selection and purification. (D) Amplification of linker sequences for assembly and restriction enzyme digestion of linkers to ensure directional cloning. 5' and 3' linkers were amplified and cut with HindIII and SacII, respectively. No-template controls (NTC) were included to control for PCR artefacts and DNA contamination. Left: analytical sample application; right: preparative sample application. Image was recorded after gel excision. (E) Successful ligation of linkers to DNA fragments can be analyzed using PCR with an increased number of PCR cycles (32) and controlled by performing no template controls with H2O (NTC) or using the NTC from the previous nick translation step as input (NTC NT)). It is important to include a no fragment control (NFC), which is an amplification from a ligation and nick translation reaction from which the MNase fragments were omitted. Only samples in which MNase fragments have been combined with linker DNA produce the expected amplicon (869 bp). Please click here to view a larger version of this figure.
500 mM EGTA | Sigma Aldrich | 03777-10G | 1.4., Inactivation of Mnase |
Novex Hi-Density TBE Sample Buffer | Thermo Fisher Scientific | LC6678 | 2.1. |
Novex® TBE Gels, 20%, 10 well | Thermo Fisher Scientific | EC6315BOX | 2.1., pre-made 20 % PAGE gel |
O'RangeRuler 5 bp DNA Ladder, | Thermo Fisher Scientific | SM1303 | 2.1. |
Novex® TBE Running Buffer | Thermo Fisher Scientific | LC6675 | 2.1., PAGE gel running buffer |
Disposable scalpel, sterile | VWR | 233-5363 | 2.3., other equivalent reagents may be used |
SYBR Green I nucleic acid stain (1000x concentrate in DMSO) | Sigma Aldrich | S9430 |
2.3. +2.5., also available from Thermo Fisher Scientific (S7563) |
UltraPure Phenol:Chloroform:Isoamyl Alcohol (25:24:1) | Thermo Fisher Scientific | 15593-031 | 3.6.1. + 4.3., other equivalent reagents may be used |
Glycogen | Sigma | 10901393001 | 3.6.4., other equivalent reagents may be used |
3M Sodium acetate , pH5.2 | Thermo Fisher Scientific | R1181 | 3.6.4., other equivalent reagents may be used |
Ethanol | 3.6.4. + 9.1.8., molecular biology grade | ||
Quick blunting kit | New England Biolabs | E1201 | 4.1. |
ammomium acetate | Sigma | A1542 |
3.1., other equivalent reagents may be used |
magnesium acetate | Sigma | M5661 |
3.1., other equivalent reagents may be used |
0.5 M EDTA (pH 8.0) | VWR | MOLEM37465520 (or Promega V4231) | 2.2. + 3.1., other equivalent reagents may be used |
Agencourt AMPure XP beads | Beckman coulter | A63881 | 5.3. + 6.5. |
Gel extraction kit | QIAGEN | 28704 | 5.7.+ 7.1. +8.4., other equivalent reagents may be used |
concentrated T4 DNA ligase | New England Biolabs | M0202T | 6.1.+ 8.1.2. |
Long Amp Taq 2X Master Mix | New England Biolabs | M0287S | 6.3. |
Phusion High-Fidelity PCR Master Mix with HF Buffer | New England Biolabs | M0531S | 5.1. + 6.6., other equivalent reagents may be used |
HindIII | New England Biolabs | R0104S | 5.4.1. |
SacII | New England Biolabs | R0157S | 5.4.2. |
AgeI | New England Biolabs | R0552S | 8.2.1. |
Tris base | Sigma | 93362 | 8.1.1. |
2M MgCl | Sigma | 93362 | 8.1.1. |
dGTP,dATP, dCTP, dTTP | New England Biolabs | N0446S | 8.1.1. |
DTT | Sigam | DTT-RO |
8.1.1. |
PEG-8000 | Sigma | P5413 |
8.1.1. |
NAD | Sigma | N6522 |
8.1.1. |
T5 exonuclease | New England Biolabs | M0363S | 8.1.2. |
Phusion DNA polymerase | New England Biolabs | M0530S | 8.1.2. |
Taq DNA ligase | New England Biolabs | M0208L | 8.1.2. |
rSAP | New England Biolabs | M0371S | 8.3.1. |
TG1 competent cells | Lucigen | 60502-1 | 9.1. |
1mm gap electroporation cuvettes | VWR | 732-2267 | 10.2. |
Bio-Assay Dish (Polystyrene, 245 mm x 245 mm x 25 mm) | Fisher Scientific | DIS-988-010M | 9.4. |
NaCl | Sigma | S7653 | 9.3. |
Bacto-tryptone | BD | 211705 | 9.3. |
Yeast extract | BD | 212750 | 9.3. |
Agar | Sigma | A1296 |
9.4. |
Glycerol | Sigma | G5516 |
9.17. |
MNAse | New England Biolabs | M0247S | 1.1. |
Nanodrop | Thermo Fisher Scientific | ND-2000 | throughout |
Micropulser | Biorad | 165-2100 | 10.2. |
Electroporation cuvettes | Biorad | 732-2267 | 10.2. |
250 ml centrifuge tubes | Corning | 430776 | 9.1-9.9. |
The popularity of the CRISPR/Cas9 system for both genome and epigenome engineering stems from its simplicity and adaptability. An effector (the Cas9 nuclease or a nuclease-dead dCas9 fusion protein) is targeted to a specific site in the genome by a small synthetic RNA known as the guide RNA, or gRNA. The bipartite nature of the CRISPR system enables its use in screening approaches since plasmid libraries containing expression cassettes of thousands of individual gRNAs can be used to interrogate many different sites in a single experiment.
To date, gRNA sequences for the construction of libraries have been almost exclusively generated by oligonucleotide synthesis, which limits the achievable complexity of sequences in the library and is relatively cost-intensive. Here, a detailed protocol for CORALINA (comprehensive gRNA library generation through controlled nuclease activity), a simple and cost-effective method for the generation of highly complex gRNA libraries based on enzymatic digestion of input DNA, is described. Since CORALINA libraries can be generated from any source of DNA, plenty of options for customization exist, enabling a large variety of CRISPR-based screens.
The popularity of the CRISPR/Cas9 system for both genome and epigenome engineering stems from its simplicity and adaptability. An effector (the Cas9 nuclease or a nuclease-dead dCas9 fusion protein) is targeted to a specific site in the genome by a small synthetic RNA known as the guide RNA, or gRNA. The bipartite nature of the CRISPR system enables its use in screening approaches since plasmid libraries containing expression cassettes of thousands of individual gRNAs can be used to interrogate many different sites in a single experiment.
To date, gRNA sequences for the construction of libraries have been almost exclusively generated by oligonucleotide synthesis, which limits the achievable complexity of sequences in the library and is relatively cost-intensive. Here, a detailed protocol for CORALINA (comprehensive gRNA library generation through controlled nuclease activity), a simple and cost-effective method for the generation of highly complex gRNA libraries based on enzymatic digestion of input DNA, is described. Since CORALINA libraries can be generated from any source of DNA, plenty of options for customization exist, enabling a large variety of CRISPR-based screens.
The popularity of the CRISPR/Cas9 system for both genome and epigenome engineering stems from its simplicity and adaptability. An effector (the Cas9 nuclease or a nuclease-dead dCas9 fusion protein) is targeted to a specific site in the genome by a small synthetic RNA known as the guide RNA, or gRNA. The bipartite nature of the CRISPR system enables its use in screening approaches since plasmid libraries containing expression cassettes of thousands of individual gRNAs can be used to interrogate many different sites in a single experiment.
To date, gRNA sequences for the construction of libraries have been almost exclusively generated by oligonucleotide synthesis, which limits the achievable complexity of sequences in the library and is relatively cost-intensive. Here, a detailed protocol for CORALINA (comprehensive gRNA library generation through controlled nuclease activity), a simple and cost-effective method for the generation of highly complex gRNA libraries based on enzymatic digestion of input DNA, is described. Since CORALINA libraries can be generated from any source of DNA, plenty of options for customization exist, enabling a large variety of CRISPR-based screens.