Diagnosis of Eimeria infection in chickens remains demanding. Parasite morphology- and host pathology-led approaches are commonly inconclusive, while molecular approaches based on PCR have proven demanding in cost and expertise. The aim of this protocol is to establish loop-mediated isothermal amplification (LAMP) as a straightforward molecular diagnostic for eimerian infection.
Eimeria species parasites, protozoa which cause the enteric disease coccidiosis, pose a serious threat to the production and welfare of chickens. In the absence of effective control clinical coccidiosis can be devastating. Resistance to the chemoprophylactics frequently used to control Eimeria is common and sub-clinical infection is widespread, influencing feed conversion ratios and susceptibility to other pathogens such as Clostridium perfringens. Despite the availability of polymerase chain reaction (PCR)-based tools, diagnosis of Eimeria infection still relies almost entirely on traditional approaches such as lesion scoring and oocyst morphology, but neither is straightforward. Limitations of the existing molecular tools include the requirement for specialist equipment and difficulties accessing DNA as template. In response a simple field DNA preparation protocol and a panel of species-specific loop-mediated isothermal amplification (LAMP) assays have been developed for the seven Eimeria recognised to infect the chicken. We now provide a detailed protocol describing the preparation of genomic DNA from intestinal tissue collected post-mortem, followed by setup and readout of the LAMP assays. Eimeria species-specific LAMP can be used to monitor parasite occurrence, assessing the efficacy of a farm’s anticoccidial strategy, and to diagnose sub-clinical infection or clinical disease with particular value when expert surveillance is unavailable.
إنتاج الدجاج العالمي زاد عشرة أضعاف على مدى السنوات ال 50 الماضية مع العالم النامي تستضيف ما يقرب من أربعة أضعاف التوسع الذي شهدته بلدان العالم المتقدم (www.faostat.org) . كما نمت أهمية إنتاج الدجاج للأمن الغذائي العالمي كذلك فعلت الملف الشخصى مسببات الأمراض التي يمكن أن تسبب مرض خطير في الدجاج. واحد مثال هي الأنواع الأيمرية، الطفيليات في كل مكان والتي يمكن أن تسبب المرض المعوي الكوكسيديا 1. أينما وتربى الدجاج من المرجح أن تكون مشتركة 2-4 واحد أو أكثر من الأنواع الأيمرية. في العالم المتقدم يتم التحكم الأيمرية المقام الأول عن طريق الوقاية الكيميائية، وتوظيف برامج المكوك أو دوران للحد من تأثير المقاومة 5. وتستخدم اللقاحات الحية أيضا في أنظمة حيث القيمة الطيور كافية لتبرير التكلفة (على سبيل المثال، تربية الماشية، والطبقات وبعض الفراريج 5). ونتيجة لدورة الفتشوبLT هذه التدابير غالبا ما تسيطر الكوكسيديا السريري بشكل جيد، على الرغم من العدوى دون السريرية هو شائع 5. في التطعيم العالم النامي أمر نادر وتطبيق المخدرات في كثير من الأحيان أبلغ أقل أيضا. ونتيجة لذلك الكوكسيديا الفرعي السريرية والسريرية هو أكثر شيوعا ويمارس تأثير اقتصادي كبير 3.
وقد اعتمد تشخيص العدوى eimerian تقليديا على الآفة وسجل بعد الوفاة، على الرغم من أن الكتاب من سجل النظام الأكثر استخداما على نطاق واسع وعلق أنه بالنسبة لبعض الأنواع "يبدو المشكوك فيه ما إذا كان ينبغي حاول هذا الإجراء في أي ولكن باعتدال شديدة العدوى" (6). ويمكن جمع أدلة التكميلي من خلال الكشف المجهري للمقاومة للبيئة مرحلة البيوض المتكيسة دورة الحياة في عينات البراز أو القمامة، على الرغم من تداخل التشكل يمكن أن نخلط جميع ولكن الخبير 6،7. بدائل الجزيئية باستخدام تفاعل البلمرة المتسلسل (PCR)، amplificatio عشوائيوقد ن من متعدد الأشكال DNA PCR (RAPD-PCR) والتكنولوجيات PCR الكمي متاح لمدة تصل إلى 20 سنوات 8-10، ولكن حتى الآن فشلوا لتصبح شعبية. حساب النسبي ومتطلبات معدات المختبرات المتخصصة أو معالجة حدت امتصاص، وعلى الرغم من الطبيعة في كثير من الأحيان غير موضوعية وتطلبا من الناحية الفنية من pathology- كبار السن والنهج القائم على الفحص المجهري 10،11. وهذه القيود يمكن أن يكون مبالغا فيه في كثير من المناطق الأكثر فقرا من العالم مثل جنوب شرق آسيا، حيث قد يكون تأثير الكوكسيديا على الفقر أكبر نسبيا 12. وردا على ذلك هناك طلب واضح عن الجديد واضحة وحساسة، ولكن فعالة من حيث التكلفة، فحوصات تشخيصية الأيمرية أنواع محددة.
متحاور التضخيم (LAMP) بوساطة حلقة هو وسيلة سهلة لإعداد DNA تقنية يحركها البلمرة التي هي قادرة على تضخيم كميات كبيرة من الحمض النووي. الأهم من ذلك، يستخدم LAMP على polymera بتوقيت جرينتش DNAحد ذاته بدلا من البلمرة DNA طق التي يشيع استخدامها في PCR، مما يسهل تضخيم DNA عند درجة حرارة ثابتة واحدة دون الحاجة لركوب الدراجات الحرارية 13،14. LAMP يمكن أن تكون قابلة للتطبيق حتى في المختبر الأكثر بدائية أو في الميدان. ومن خلال تميزها المقاومة النسبية للعديد من مثبطات PCR، وحساسية عالية وخصوصية، تم وضع المقايسات LAMP لمجموعة واسعة من مسببات الأمراض بما في ذلك فيروس داء الغومبورو، المطثية الحاطمة والكريبتوسبوريديوم 15-17. وردا على الطلب على التشخيص الأيمرية فعالة من حيث التكلفة أنواع محددة جديدة وقد وضعت لجنة من المقايسات LAMP محددة لكل من سبعة أنواع الأيمرية التي تصيب الدجاج 18. وتشمل التطبيقات لفحوصات جديدة للرصد الطفيل واقعة ذات قيمة خاصة نظرا لارتباط الأنواع مثل الأيمرية ماكسيما أو الأيمرية الفاتكة مع المؤسسة العامة الاقتصادي الضعيفrformance 3،4. وتشمل التطبيقات الأخرى تقييم فعالية الاستراتيجية المزرعة anticoccidial، تشخيص العدوى دون السريري أو المرض السريري وتقييم المخاطر التي يشكلها الأيمرية إلى مزرعة.
The Eimeria species-specific LAMP assays described in this paper offer a new diagnostic tool kit in support of effective control of coccidia and the disease coccidiosis. The outcomes of eimerian infection can include severe economic loss as well as seriously compromised bird welfare and increased susceptibility to colonisation by zoonotic pathogens21. Opportunities to monitor flocks for the occurrence of some, or all Eimeria species can provide early warning of a breakdown in anticoccidial control efficacy. Key advantages of LAMP include robust target specificity, resulting from the requirement for six different DNA sequence targets, as well as high sensitivity, boosted by the inclusion of loop primers13, although the qualitative, not quantitative nature of LAMP may be considered a limitation. It is not currently possible to discriminate low level parasite escape from routine chemoprophylaxis or live vaccine replication from unchecked eimerian replication. Nonetheless, the technical ease of the protocol and definitive readout offers considerable improvement over the existing specialist and frequently subjective pathology- and morphology-led approaches6,7. Each assay may be completed at a cost of ~£0.75 per sample, independent of labour and equipment set up expenses. Thus, LAMP assays are also more cost effective than other molecular diagnostics such as PCR, since they require an isothermal incubation with no need for specialist equipment.
For many years access to Eimeria genomic DNA as template has limited the development and application of molecular field diagnostics. The oocyst is the most readily accessible phase of the eimerian lifecycle, but routine DNA extraction requires laboratory facilities22. Other, more labile intestinal lifecycle stages require purification prior to DNA preparation to prevent PCR inhibition and a consequent loss of sensitivity23,24. The ability to extract eimerian DNA of a quality suitable for LAMP using equipment no more specialised than a microcentrifuge and a water bath, supplemented by inhibitor adsorption using chelex resin, now promotes the wider use of molecular biology in eimerian diagnostics. Intriguingly, the reported detection of quantitative PCR-measurable Eimeria DNA in intestinal tissue 20 days after the initiation of parasite infection, 11 days after the last detectable oocyst output, raises the suggestion that LAMP may be used to detect resolved parasite exposure as well as ongoing infection, even after any visible lesions may have been resolved25.
The relatively low cost and low technical requirements of LAMP Eimeria diagnostics can promote their application in the developing world where other more established approaches may not be available or appropriate. For this to be applicable each assay must be capable of detecting all strains which may be circulating within each region. While understanding of the genetic diversity prevailing among Eimeria species is limited26, the use of target sequences previously validated for use in quantitative PCR with strains from Africa, Asia, Europe and South America provides some evidence of conservation, supporting the utility of these LAMP assays around the world10.
The authors have nothing to disclose.
The work carried out in this study was supported in part by the Royal Veterinary College through the student research projects fund, as well as the Biotechnology and Biological Sciences Research Council and the Department for International Development (grant number BB/H009337/2). This manuscript has been assigned the reference PPB_00795 by the RVC.
Name | Company | Catalogue number | Comments |
RNAlater | Ambion | AM7024 | |
Ethanol | VWR Chemicals | 20821.321 | Caution, highly flammable |
100 x Tris-EDTA (TE) buffer concentrate | Sigma-Aldrich | T9285 | |
Chelex 100 resin | Bio-Rad | 142-1253 | |
Molecular grade water | Invitrogen | 10977035 | |
E. acervulina F3 | Sigma-Aldrich | VC00021 | *CCTAACATTTCGCTTCACGGAC |
E. acervulina B3 | Sigma-Aldrich | VC00021 | *ATGAGCAAGTGGAACACCTTG |
E. acervulina FIP | Sigma-Aldrich | VC00021 | *AGAGCACAGTGGCAGTGC-AGCAGACAGCATGGCTTACCT |
E. acervulina BIP | Sigma-Aldrich | VC00021 | *GAAGACCCTCTGAAGAACGGA-CCTTCTCACCGCTTACCGG |
E. acervulina LB | Sigma-Aldrich | VC00021 | *TAAGGTTACACCCGTGGAGG |
E. acervulina LF | Sigma-Aldrich | VC00021 | *GCCATGCACAAAGCGACTT |
E. brunetti F3 | Sigma-Aldrich | VC00021 | *GGCCATCAAGTTCCATGAGC |
E. brunetti B3 | Sigma-Aldrich | VC00021 | *TCAACCTCCTGAGTGTGGTT |
E. brunetti FIP | Sigma-Aldrich | VC00021 | *GAAAATGCCTTCGTAGCTGCT-GCTGGGTACGGAGCGTCTT |
E. brunetti BIP | Sigma-Aldrich | VC00021 | *TACTTCCTAGGATCCATCCTCGC-AGTTTCGCTGCCGCCTC |
E. brunetti LB | Sigma-Aldrich | VC00021 | *GAAACGCTCGAACATGGC |
E. brunetti LF | Sigma-Aldrich | VC00021 | *CTTCTCCACAGACCCAGAGGT |
E. maxima F3 | Sigma-Aldrich | VC00021 | *ACTACGGAAAAGTGCGTAGCT |
E. maxima B3 | Sigma-Aldrich | VC00021 | *CCTTCCTCCCTTCTGAAAACTG |
E. maxima FIP | Sigma-Aldrich | VC00021 | *GAGTCACTGCTGATGTACCAAA AG-GAACTATGCCGCTTTCCCCTG |
E. maxima BIP | Sigma-Aldrich | VC00021 | *AGAATGCGGATTTGTTAGCAGC-AGCAAGTCCAAGGTGTGTGTA |
E. maxima LB | Sigma-Aldrich | VC00021 | *CAAGCCTACGCGGACATC |
E. maxima LF | Sigma-Aldrich | VC00021 | *TTATGCAGCTGGGTCAACG |
E. mitis F3 | Sigma-Aldrich | VC00021 | *ACGATAGCCAAGACACGTAAGG |
E. mitis B3 | Sigma-Aldrich | VC00021 | *CCCCGTGATAAGAGTAGGAACA |
E. mitis FIP | Sigma-Aldrich | VC00021 | *CGCGGGTCGTGAGATTTAAATT AT-GGAAGATCAGGACGGGCACT |
E. mitis BIP | Sigma-Aldrich | VC00021 | *GTTTCAGTTGATGAACAAGCGA GA-TGCGCCTCTAGAATCAAGACG |
E. mitis LB | Sigma-Aldrich | VC00021 | *TCCATGCATCCCCTTGTT |
E. mitis LF | Sigma-Aldrich | VC00021 | *CGTGGGCACAGATTGATTC |
E. necatrix F3 | Sigma-Aldrich | VC00021 | *TGGCTTTCCCGCGTACC |
E. necatrix B3 | Sigma-Aldrich | VC00021 | *CGGCCCAACACAAAGACTG |
E. necatrix FIP | Sigma-Aldrich | VC00021 | *CGCTTGAGTTTTAAGCTATGCA CA-GACCCAAGCAGCTCACCAA |
E. necatrix BIP | Sigma-Aldrich | VC00021 | *CGCCATGCCATTCAATGAACG-*GAGGCATACCGGCGTTGTC |
E. necatrix LB | Sigma-Aldrich | VC00021 | *GTCTGTAACTTGGGACGTTGT |
E. necatrix LF | Sigma-Aldrich | VC00021 | *GAACAGCCGGAGCCTCTC |
E. praecox F3 | Sigma-Aldrich | VC00021 | *GCCCTTGTATGTTGCTGTTTCT |
E. praecox B3 | Sigma-Aldrich | VC00021 | *GCGCACGAATCTGAATCACAC |
E. praecox FIP | Sigma-Aldrich | VC00021 | *ATCTCCTCAAAGACTTTCGCGT A-GCGCTTGGCTATATCCATAGG |
E. praecox BIP | Sigma-Aldrich | VC00021 | *GCTCTCGTGGCATACTTGC-GCCAGGAGCCACTGATTGT |
E. praecox LB | Sigma-Aldrich | VC00021 | *GAATAGCATTGCCAGGTGG |
E. praecox LF | Sigma-Aldrich | VC00021 | *GTCCACTGTCATTAATATTGC TGC |
E. tenella F3 | Sigma-Aldrich | VC00021 | *GCTTGTGAAGGTCAGCGTG |
E. tenella B3 | Sigma-Aldrich | VC00021 | *GCTGAGTCCATACGTACTTCCT |
E. tenella FIP | Sigma-Aldrich | VC00021 | *GCCACTGCTATGGAAAGTCAC AC-CATAACTGGCATGCAGGGGT |
E. tenella BIP | Sigma-Aldrich | VC00021 | *GTTTGGCCCGAAAGTTGTGAA GA-CGTCAGAAATTGCTGCCCAAT |
E. tenella LB | Sigma-Aldrich | VC00021 | *CGCATGTGCAGTTGAAGACA |
E. tenella LF | Sigma-Aldrich | VC00021 | *CCAAATGTATCTGCTAGTTATA TTAACAAG |
10 x ThermoPol reaction buffer | New England Biolabs | B9004S | |
MgSO4 | Sigma-Aldrich | M7506 | |
dNTPs | Promega | U1330 | |
Betaine solution (5 M) | Sigma-Aldrich | B0300 | |
Bst polymerase | New England Biolabs | M0275S | |
Hydroxynaphthol blue | Sigma-Aldrich | 33936 | Dissolved in molecular grade water. |
UltraPure agarose | Invitrogen | 16500-500 | |
10 x Tris/Borate/EDTA (TBE) buffer | Invitrogen | AM9863 | |
Blue/Orange DNA loading dye (x6) | Promega | G1881 | |
GeneRuler 1Kb DNA ladder | Thermo Scientific | SM0313 | |
SafeView nucleic acid stain | NBS Biologicals | NBS-SV |