Massively Parallel Reporter Assays in Cultured Mammalian Cells

Alexandre Melnikov; Xiaolan Zhang; Peter Rogov; Li Wang; Tarjei S. Mikkelsen

doi:10.3791/51719

JoVE Journal > Biology

Please note that all translations are automatically generated. Click here for the English version.

Biologia

מבחני כתב מקבילים מסיבי בתאי יונקים בתרבית

Published: August 17, 2014

doi:

10.3791/51719

Alexandre Melnikov¹, Xiaolan Zhang¹, Peter Rogov¹, Li Wang¹, Tarjei S. Mikkelsen¹

¹Broad Institute

Summary

The genetic reporter assay is a well-established and powerful tool for dissecting the relationship between DNA sequences and their gene regulatory activities. Coupling candidate regulatory elements to reporter genes that carry identifying sequence tags enables massive parallelization of these assays.

Abstract

The genetic reporter assay is a well-established and powerful tool for dissecting the relationship between DNA sequences and their gene regulatory activities. The potential throughput of this assay has, however, been limited by the need to individually clone and assay the activity of each sequence on interest using protein fluorescence or enzymatic activity as a proxy for regulatory activity. Advances in high-throughput DNA synthesis and sequencing technologies have recently made it possible to overcome these limitations by multiplexing the construction and interrogation of large libraries of reporter constructs. This protocol describes implementation of a Massively Parallel Reporter Assay (MPRA) that allows direct comparison of hundreds of thousands of putative regulatory sequences in a single cell culture dish.

Introduction

מבחני כתב מקבילים מסיבי (MPRA) מאפשרים מדידה מרובבת של פעילות הרגולטורית תעתיק של אלפים למאה אלפי רצפי DNA ^{1 7.} ביישום הנפוץ ביותר שלהם, ריבוב מושגת על ידי צימוד כל רצף של עניין לגן כתב סינטטי המכיל תג זיהוי רצף במורד הזרם של מסגרת קריאה פתוחה (ORF; איור 1). בעקבות transfection, בידוד RNA ורצף עמוק של קצוות "3 של תעתיקי גן הכתב, הפעילויות היחסית של הרצפים בשילוב ניתן להסיק מהשפע היחסי של תגי זיהוי שלהם.

איור 1 סקירה כללית של MPRA. ספרייה של כתב MPRA בונה בנויה על ידי צימוד רצפים רגולטוריים המשוערת לסינטטיגני כתב שיכללו "אינרטי" ORF (כגון GFP או לוציפראז) ואחריו תג זיהוי רצף. הספרייה היא transfected בהמוניהם לאוכלוסייה של תאים בתרבית וmRNA הכתב עיבד הוא התאושש לאחר מכן. רצף עמוק משמש לספירת מספר המופעים של כל תג בקרב mRNAs הכתב ופלסמידים transfected. היחס של mRNA סופר על יכול לשמש ספירת פלסמיד להסיק הפעילות של רצף הרגולציה המתאים. מותאם באישור מלניקוב, et al ^2.

ניתן להתאים MPRA למגוון רחב של עיצובים ניסיוניים, כולל 1 mutagenesis) המקיף של יסודות רגולציה גן בודד, 2 סריקה) לאלמנטים רגולטוריים רומן על פני מוקד של עניין, 3) בודק את ההשפעה של שונות גנטיות טבעיות בקבוצה של משוער יזמים, משפרי או משתיקי קול, ו4) הנדסה למחצה רציונאלית של אלמנטים רגולטוריים סינטטיים. ליbraries של גרסאות רצף יכול להיות שנוצר תוך שימוש במגוון של שיטות, כולל סינתזת ספריית oligonucleotide (OLS) על microarrays תכנות ^2,3,6,7, הרכבה של oligonucleotides המנוון ^1,4, קשירה קומבינטורית ⁸ ופיצול של הדנ"א הגנומי ^5.

פרוטוקול זה מתאר בנייה של ספרייה של אמרגן גרסאות באמצעות OLS ווקטורי pMPRA1 וpMPRAdonor1 (Addgene מזהים 49,349 ו49,352, בהתאמה; http://www.addgene.org), transfection החולף של ספרייה זו לתאי יונקים בתרבית וquantitation הבא של פעילויות האמרגן ידי רצף עמוק של התגים הקשורים בם (Tag-Seq). גרסאות קודמות של פרוטוקול זה היו בשימוש במחקר דיווח מלניקוב et al. טבע 30 ביוטכנולוגיה, 271-277 (2012) ובKheradpour et al. הגנום 23 מחקר, 800-811 (2013).

Protocol

.1 רצף עיצוב וסינתזה בגין MPRA עם העיצוב וסינתזה של רצפים להיות assayed לפעילות רגולציה. לתאימות עם סדרת וקטור pMPRA, לעצב כל רצף באמצעות התבנית הבאה: var -GGTACCTCTAGA- תג 5'-ACTGGCCGCTTCACTG- -AGATCGGAAGAGCGTCG-3 "שבו var מציין את הרצף להיות assayed ותג מציין את אחד או יותר תגי זיהוי. שני האזורים משתנים (var ותג) מופרדים על ידי זוג KpnI (GGTACC) וXbaI אתרי הגבלה (TCTAGA) כדי להקל על קשירה כיוונית של בר גן הכתב ביניהם. בנוסף, שני אתרים ייחודיים SfiI (GGCCNNNNNGGCC) יתווספו על ידי PCR כדי לאפשר קשירה כיוונית לתוך עמוד השדרה pMPRA. האזורים משתנים אינם יכולים להכיל עותקים נוספים של כל אחד מאתרי הגבלה אלה. במידת הצורך, אחד או יותר מאנזימי הגבלה אלה יכול להיות מוחלף, כל עוד המחליפים 1) לאפשר חיתוך יעיל קרוב לקצוות של מולקולות DNA, ו2) לא לחתוך במקום אחר ברצף הווקטור. ראה דיון לפרטים נוספים. להשיג פריימרים הנדרשים מפורטים בטבלה 1 מספק מסחרי. MPRA_SfiI_F GCTAAGGGCCTAACTGGCCGCTTCACTG MPRA_SfiI_R GTTTAAGGCCTCCGTGGCCGACGCTCTTC TAGseq_P1 AATGATACGGCGACCACCGAGATCTACACT CTTTCCCTACACGACGCTCTTCCGATCT TAGseq_P2 CAAGCAGAAGACGGCATACGAGAT [אינדקס] GT GACTGGAGTTCAGACGTGTGCTCTTCCGATCTCGAGG טבלת 1 רצפי פריימר. [אינדקס] מציינים רצף מדד 6 עד 8 NT המשמש לקביעת רצף מרובבת. להשיג לפחות 8 פריימרים TagSeq-P2 עם מדדים שונים. כלשל פריימרים צריכים להיות מטוהר על ידי HPLC או עמוד. ניתן להשיג בספריות oligonucleotide ממתקן ספק או ליבה מסחרי, או שנוצרו על ידי שימוש בסינתיסייזר oligonucleotide מבוסס microarray לתכנות כפי שתואר על ידי היצרן. Resuspend מוצרי OLS ב100 חיץ μl TE 0.1. הפעל את ספריות oligonucleotide על 10% TBE-אוריאה denaturing ג'ל polyacrylamide. לטעון כ 1 pmol לכל נתיב ואת כתם עם כתם ניאון ssDNA רגיש כדי להעריך (איור 2 א) איכותם. אם ניתן דמיינה להקה בדידה המתאימה לoligonucleotides באורך מלא (איור 2 א, מסלולי 1 ו -2), תחתוך את פרוסת ג'ל acrylamide המתאימה וelute oligonucleotides ל100 μl TE 0.1 לילה בטמפרטורת חדר עם רעד. אם לא, המשך שימוש בהשעית OLS הגלם. להגביר ולהוסיף זנבות SfiI לספריית oligonucleotide באמצעות תחליב 9 PCR </ sup>. הגדר את תערובות תגובת PCR 50 μl כפי שמתואר בטבלה 2. ואז לשלב עם 300 תערובת μl שמן וחומרים פעילי שטח מMicellula DNA אמולסיה וערכת טיהור ומערבולת במשך 5 דקות ב 4 ° C.. מגיב נפח 1x (μl) Herculase השני Fusion DNA פולימראז 0.5 מאגר תגובת 5x Herculase השני 10 dNTP (10 מ"מ כל אחד) 1.25 BSA (20 מ"ג / מ"ל) 1.25 MPRA_SfiI_F פריימר (25 מיקרומטר) 0.25 MPRA_SfiI_R פריימר (25 מיקרומטר) 0.25 תבנית OLS (1-10 attomol) משתנה nuclease ללא מים ל50 ve_content "> לוח 2: תערובת תגובת אמולסיה PCR (שלב מים). השתמש בריכוז שנותן את התשואה המקסימלי של מוצרי הגברה ללא המראה של חפצים (ראה סעיף 1.12). לוותר תחליב שנוצר לתוך צינורות PCR ולבצע 20 מחזורים של PCR (2 דקות ב95 מעלות צלזיוס, 20 x [20 שניות על 95 מעלות צלזיוס, 20 שניות על 55 מעלות צלזיוס, 30 שניות ב72 ° C], 3 דקות ב95 מעלות צלזיוס). בריכה ולשבור כל תגובת PCR תחליב 350 μl על ידי הוספת isobutanol 1 מ"ל ובקצרה vortexing, ולאחר מכן לטהר את מוצר ההגברה באמצעות טור טיהור DNA. הפעל aliquot על 2% או 4% agarose ג'ל כדי לוודא הגברה ללא ממצא (איור 2). הכנת איור 2 ספריות סינתזת oligonucleotide.) </sטרונג> שלוש ספריות שונות גלם סינתזת oligonucleotide (OLS) לרוץ על denaturing ג'ל polyacrylamide TBE-אוריאה 10%. יכולות להיות דמיינו להקות המתאימות oligonucleotides באורך מלא (*) ונכרתו מן הספריות 1 ו -2 ספרייה 3 מכילה מזהמים שמפריעים לטיהור עמוד. אם זה המקרה, המשך למוצרי PCR הגברה. ב) להגברת PCR פתוחה ותחליב של אותו לרוץ ספריית oligonucleotide ישירות על ג'ל agarose. ההגברה PCR של ספריות oligonucleotide מורכבות לעתים קרובות יוצרת מוצרי chimeric וממצאים אחרים שעלולות להופיע כלהקות גבוהות יותר ונמוכות יותר. תחליב PCR יכול למזער החפצים האלה. .2 בניית ספרייה הכן עמוד השדרה פלסמיד לינארית על ידי pMPRA1 וקטור לעכל עם SfiI ב50 מעלות צלזיוס למשך 2 שעות, לרוץ על 1% agarose ג'ל, בלו להקת עמוד השדרה (במקרה זה, 2.5 kb) ולטהר אותו באמצעות טור ספין ג'ל לטיהור. Digestמוצרי PCR התחליב מהשלב 1.4 עם SfiI ב50 מעלות צלזיוס למשך 2 שעות ולטהר באמצעות עמודות טיהור DNA. ולקשור ספריית אמרגן התג לתוך עמוד השדרה הווקטור לינארית, שהוקם תגובות המכילות את מוצר PCR מתעכל 100 ng, 50 ng של עמוד השדרה וקטור לינארית ואנזים T4 DNA. דגירה הלילה ביום 16 במעלות צלזיוס ולאחר מכן חום על 65 מעלות צלזיוס למשך 20 דקות כדי להשבית האנזים. להפוך E. coli עם תגובת קשירה. כדי לשמר את מורכבות ספרייה, שואף להשיג לפחות 10x יותר CFU מאשר יש שילובי אמרגן תג נפרדים בספרייה שנועדה. כאשר המספר הכולל של תגים הוא כ -100,000, CFU היעד יכול בדרך כלל להיות מושגת על ידי ביצוע 6-8 תמורות מקבילות לספרייה. עבור כל שינוי, לשלב 50 μl electrocompetent E. קולי תאים עם 2 μl של תמהיל קשירה על קרח. להפוך על ידי electroporation, לשחזר את התאים ב800 SOC μlבינוני על ידי טלטול ב 37 מעלות צלזיוס במשך שעה 1, ולאחר מכן לשלב את התאים מהתמורות המקבילות. על מנת להעריך את יעילות השינוי, צלחת דילולים סדרתי מalinquot של תאים התאוששו על צלחות אגר LB עם 50-100 מיקרוגרם / מ"ל carbenicillin ודגירת הלילה בשעה 37 מעלות צלזיוס. להעריך CFU כולל, כפי ש( CFU נצפה) × (דילול גורם) × (V – v) / נ ', שבו V הוא הנפח הכולל של תאים ונ התאוששו הוא היקף aliquot נלקח לדילולים הסידוריים. במקביל, השתמש בשארית התאים התאוששו לחסן 200 מ"ל LB בתוספת 100 מיקרוגרם / מ"ל carbenicillin. לגדל תאים ב37 מעלות צלזיוס למשך לילה בחממה שייקר ואז לבודד את פלסמיד דנ"א בעקבות הליכים סטנדרטיים. לעכל aliquot של ספריית פלסמיד המבודדת עם SfiI ב50 מעלות צלזיוס למשך 2 שעות ולרוץ על 1% agarose ג'ל כדי לאשר את קיומו של מוסיף. Linearize ספריית פלסמיד על ידי גutting בין גרסאות האמרגן והתגים באמצעות KpnI וXbaI. על מנת למקסם את יעילות העיכול, לבצע digestions הסידורי: ראשית, לעכל עם KpnI על 37 מעלות צלזיוס במשך שעה 1 ולטהר באמצעות חרוזים מגנטיים. שנית, לעכל עם XbaI עם תוספת של 1 שרימפס U אלקליין phosphatase ב37 מעלות צלזיוס למשך 2 שעות, חום להשבית על 65 מעלות צלזיוס למשך 5 דקות, ולאחר מכן לטהר באמצעות חרוזים מגנטיים. הפעל aliquot על 1% agarose ג'ל כדי לוודא ליניאריזציה מלאה. אם פלסמיד לא חתוך גלוי, הבר לינארית צריך להיות מטוהר ג'ל. כדי ליצור ספריית MPRA מתאימה לtransfection לתוך תאי יונקים, ולקשור ORF עם KpnI קצות -compatible / XbaI לתוך ספריית ביניים לינארית. כדי להכין luc2 בר ORF תואם מpMPRAdonor1, לעכל פלסמיד זה עם KpnI וXbaI על 37 מעלות צלזיוס במשך שעה 1 ולרוץ על 1% agarose ג'ל. בלו בר ORF (1.7 kב במקרה זה) ולטהר באמצעות טור ספין טיהור ג'ל. Clone בר ORF לתוך ספריית ביניים לינארית כפי שמתואר בצעדים 2.3-2.8. לעכל aliquot (המקביל ל 1-2 מיקרוגרם) של ספריית MPRA עם KpnI על 37 מעלות צלזיוס במשך שעה 1 ולרוץ על 1% agarose ג'ל. אם הספרייה מתעכל פועלת כלהקה אחת, המשך לסעיף 3 אם להקות נוספות הם נצפו (בדרך כלל מתאים לשריד של מבני ביניים), הספרייה יכולה להיות מטוהרים נוספים כדלקמן: לעכל 3-5 מיקרוגרם של הספרייה מזוהמת בKpnI על 37 מעלות צלזיוס במשך שעה 1 ולרוץ על ג'ל agarose 0.8% הלילה ב 4 מעלות צלזיוס. בלו להקת הספרייה הנכונה, לטהר DNA באמצעות טור ספין טיהור ג'ל ולבצע קשירה עצמית באמצעות האנזים DNA T4 ריכוז גבוה ב37 מעלות צלזיוס במשך שעה 1. לאחר מכן לחזור על בידוד DNA שינוי וספרייה סופית כמתואר בשלב 2.8. .3 Transfection, הפרעות, ובידוד RNA לכל transfection העצמאי, התרבות את המספר הדרוש של תאים (כפי שנקבע על ידי מורכבות ספריית MPRA, ראה דיון) במדיום מתאים. לדוגמא, HEK293T / 17 תאי תרבות DMEM בתוספת 10% FBS וL-גלוטמין / פניצילין / סטרפטומיצין. תרבות תאים לפחות שני transfections עצמאי לכל ספרייה ותנאי ניסוי. Transfect תאים בתרבית עם פלסמידים MPRA. שיטת transfection והתנאים חייבות להיות מותאמים לכל סוג תא. עבור כל דגימה transfected, לשמור aliquot (50-100 ng) של פלסמיד דנ"א כשליטה מתאימה. לדוגמא, transfect 0.5 x 10 7 HEK293T / 17 תאים גדלו ~ מפגש 50% בצלחת תרבות 10 סנטימטר עם פלסמיד דנ"א 10 מיקרוגרם ב1 מ"ל Opti-MEM אני מופחת סרום בינוני באמצעות 30 μl Lipofectamine LTX ו10 μl פלוס מגיב. הסר את תערובת transfection לאחר 5 שעות ולאפשרתאים להתאושש במשך 24-48 שעה. לחלופין, לבצע כל ההפרעות יידרשו להפעיל רצפים רגולטוריים להיקשר או אות תלויה בספרייה שנועדה. קציר התאים ולבודד פולי () + mRNA באמצעות עמודות סטנדרטי אוליגו (DT) של תאית או מחרוזים באמצעות הוראות היצרן שלהם. ודא שקיבולת המחייב המקסימלי של העמודות או חרוזים יעלה על הסכום הכולל של mRNA הצפוי מהתאים שנקטפו. לדוגמא, התשואה הצפויה מסעיף 3.3 היא כ 0.5-2.5 מיקרוגרם mRNA. .4 Tag-Seq לחסל את השריד של DNA הווקטור מlysates תא transfected, טיפול בכל דגימת mRNA 20 μl עם μl 1 הטורבו DNase (2 U) ו2.3 חיץ μl 10x הטורבו DNase על 37 מעלות צלזיוס במשך שעה 1, להוסיף 2.4 μl טורבו DNase איון מגיב ב RT עבור 5 דקות עם ערבוב, צנטריפוגות ב 10,000 גרם ל90 שניות, ולאחר מכן להעביר את הפתרון לצינור טרי. ודא טוהר על ידי ביצוע PCR כפי שתואר בסעיף 4.6 על 60-100 ng של כל דגימת mRNA, ולאחר מכן מפעיל את המוצרים על ג'ל agarose. אם amplicons הספציפית גלויות (0.25 kb אם באמצעות pMPRA1 עם luc2), עמודה לטהר mRNA שטופל ולאחר מכן לחזור על טיפול DNase. כדי ליצור ספריות רצף Tag-Seq, להמיר mRNA הכתב לcDNA ולהוסיף מתאמי רצף על ידי PCR. הגדר את תערובות פריימר mRNA / RT כפי שמתואר בטבלה 3. לדגור על 65 מעלות צלזיוס למשך 5 דקות, ולאחר מכן מניח על קרח. במקביל, הקים תגובות סינתזת cDNA כמתואר בלוח 4. מגיב נפח 1x (μl) מדגם mRNA (400-700 כולל ng) 8 אוליגו 0dT (50 מיקרומטר) 1 dNTP (10 מ"מ כל אחד) 1 > 3 RNA תמהיל ove_content "טבלה / שעתוק הפוך פריימר לסינתזת cDNA. מגיב נפח 1x (μl) 10x עילי III RT חוצץ 2 MgCl 2 (25 מ"מ) 4 DTT (0.1 M) 2 RNaseOut (40 U / μl) 1 עילי III (200 U / μl) 1 תערובת תגובת סינתזת לוח 4: cDNA. בעדינות לשלב פריימר mRNA / RT מתערבב עם תערובות סינתזת cDNA. לדגור על 50 מעלות צלזיוס במשך 50 דקות, 85 מעלות צלזיוס למשך 5 דקות ולאחר מכן מניח על קרח. לבסוף, דגירה עם 2 H U של ribonuclease על 37 מעלות צלזיוס למשך 20 דקות. הגדר את תגובות PCR כפי שמתואר בטבלה 5 עם 4-6 μlתערובת cDNA תגובה או 50 פלסמיד כתב ng כתבניות. ואז לבצע הגברה PCR (95 מעלות צלזיוס למשך 2 דקות, 26 x [95 מעלות צלזיוס במשך 30 שניות, 55 מעלות צלזיוס במשך 30 שניות, 72 מעלות צלזיוס במשך 30 בשנייה], 72 מעלות צלזיוס במשך 3 דקות). מגיב נפח 1x (μl) 2x PfuUltra השני HotStart PCR מיקס מאסטר 25 TagSeq_P1 פריימר (25 מיקרומטר) 0.5 TagSeq_P2 פריימר (25 מיקרומטר) 0.5 תבנית (mRNA, cDNA לערבב או פלסמיד דנ"א) משתנה nuclease ללא מים ל50 לוח 5: תערובת תגובת Tag-Seq PCR. הפעל את מוצרי PCR באמצעות 2% agarose ג'ל, להקות בלו המתאימות לamplicons ספריית Tag-Seq (0.25 kb אם באמצעותpMPRA1 עם luc2) ולטהר עמודות ספין אלה באמצעות טיהור ג'ל. בריכה, לפגל ורצף amplicons Tag-Seq המטוהר ישירות עם מכשיר רצף Illumina. לסנן באיכות נמוכה קוראת על ידי הסרת כל ש) מכיל עמדה אחת או יותר עם איכות Phred להבקיע פחות מ 30 בתוך תג הרצף; או ב) אינו תואמות בדיוק את תג תוכנן. לספור את מספר פעמים שכל תג שנותר מופיע בכל ספרייה. לנרמל את ספירת התג לTPM (תגים למיליון תגי רצף) ולאחר מכן לחשב את היחס של ספירת תג נגזר mRNA על ספירת תג המופק פלסמיד עבור כל זוג של ספריות רצף. אם תגים שונים מרובים היו קשורים זה לזה וריאנט רצף, להשתמש היחסים החציוני שלהם לניתוח במורד הזרם.

Representative Results

MPRA מאפשר רזולוציה גבוהה, לנתיחה כמותי של יחסי רצף פעילותם של גורמי רגולציה תעתיק. ניסוי MPRA מוצלח בדרך כלל יניב מדידות לשחזור מאוד עבור רוב הרצפים בספריית transfected (איור 3 א). אם שחזור עני הוא ציין (איור 3 ב), זה מעיד על ריכוז נמוך מדי של mRNAs כתב בדגימות RNA התאוששו, בשל או 1) פעילות נמוכה מוחלטת בין רצפי assayed, או 2) יעילות transfection נמוכה. איור 4 מראה "טביעת רגל מידע" נציג 1,2 שנוצרה על ידי מנסה לאמוד ~ 37,000 וריאנטים של רצף 145 נ"ב במעלה הזרם של גן IFNB האנושי בתאי HEK293 עם או בלי חשיפה לוירוס סנדאי אקראיים. אמרגן TATA-box ומשפרים הפרוקסימלי ידוע 10 יכולים בבירור להיות מזוהה כregi מידע עשירתוספות באופן וירוס תלוי. איור 3 Tag-Seq שחזור. מגרשי פיזור מראים דוגמאות של נתונים Tag-Seq משני transfections לשכפל עצמאי עם גבוה (A) ואת שחזור נמוך (B). העלילה האחרונה מראה תגי נתון חריגים רבים עם ספירה הגבוהה mRNA רק באחת משתי החזרות. חפצים כגון בדרך כלל מצביעים על כך שהריכוזים של mRNAs הכתב היו נמוכים מדי עבור ההגברה PCR כמותי, גם בשל פעילות נמוכה מוחלטת בין מבני הכתב, או את יעילות transfection נמוכה. איור 4 footprinting מידע של האתר האנושי שעתוק IFNB התחלה ומשפרים הפרוקסימלי. </strאונג> כ 37,000 גרסאות אקראיות של 145 נוקלאוטיד אזור (NT) במעלה הזרם של גן IFNB האנושי היו assayed באמצעות MPRA בתאי HEK293 עם () וללא חשיפה (ב ') לוירוס סנדאי. הסורגים הכחולים להציג את המידע ההדדי בין פלט הכתב ונוקלאוטיד בכל עמדה. משפר הפרוקסימלית וTATA-box עומדים בתור אזורים של תוכן מידע גבוה על זיהום ויראלי.

Discussion

MPRA is a flexible and powerful tool for dissection of sequence-activity relationships in gene regulatory elements. The success of MPRA experiments depend on at least three factors: 1) careful design of the sequence library, 2) minimization of artifacts during amplification and cloning, and 3) high transfection efficiency.

The possible lengths of the variable regions in the reporter constructs are largely determined by the synthesis or cloning technology used. Standard OLS is generally limited to about 200 nt, but this protocol is compatible with inserts up to at least 1,000 nt. Note that variable regions that are highly repetitive or contain strong secondary structures may end up underrepresented due to PCR and cloning biases. The length of the tags that identify each of the variable regions should be 10-20 nt and the collection of tags should ideally be designed such there are at least two nucleotide differences between any pair. Tags that contain the seed sequences of known microRNA or other factors that might influence mRNA stability should also be avoided when possible.

A key parameter in the design of MPRA experiments is the total number of distinct reporter constructs to be included in the library (the design complexity, denoted C_D). In practice, C_Dis limited by the number of cultured cells that can be transfected. As a rule of thumb, the total number of transfected cells should be at least 50-100 times greater than C_D. For example, if 20 million cells can be transfected with a transfection efficiency of 50%, then C_D should be no more than ~200,000. Note that C_D is equal to the number of distinct regulatory sequence variants multiplied by the number of distinct tags per sequence. The more distinct tags are linked to each regulatory sequence, the more accurate the estimate of the activity of that sequence can be made (because measurements from distinct tags can be averaged), but the fewer distinct variants can be assayed in one experiment. The optimal choice depends on the experimental design. In a simple “promoter bashing” experiment, where a mathematical model will be fitted to the aggregated measurements, a single tag per variant is usually sufficient. In a screen for single-nucleotide polymorphisms that cause changes in regulatory activities, it may be necessary to use 20 or more tags per allele to obtain statistically robust results, because comparing each pair of alleles requires a separate hypothesis test.

If the sequences to be assayed are not expected to contain transcription start sites, a constant promoter can also be added in the same fragment. For example, pMPRAdonor2 (Addgene ID 49353) includes a minimal TATA-box promoter that is useful when the upstream variable region is expected to have significant enhancer activity, while pMPRAdonor3 (Addgene ID 49354) includes a modified, strong SV40 viral promoter that is useful when the variable region is expected to contain silencer activity or other negative regulatory elements.

Raw OLS products often contain a significant fraction of truncated oligonucleotides. These may interfere with accurate PCR amplification of the designed sequences, particularly when there is significant homology between them. Using PAGE purification to remove truncated synthesis products and emulsion PCR to minimize amplification artifacts are effective techniques for ensuring high library quality. If either step is impractical, it is imperative to minimize the number of PCR cycles used at each amplification step. Selection and expansion of the cloned library in liquid culture is generally sufficient to maintain the design complexity, but if recombination-prone vectors are to be used or significant representation bias is observed, the recovered cells can instead be plated directly onto large LB agar plates, expanded as individual colonies and then scraped off for DNA isolation. It is also important to consider the potential impact of synthesis errors, which are typically found at a rate of 1:100-500 in OLS. Full-length sequencing of the reporter constructs prior to transfection is recommended to identify and correct for such errors.

It is not necessary to introduce reporter constructs into every cell in the transfected culture, but transfection efficiencies below ~50% may lead to poor signal to noise ratios. It is advisable to optimize transfection conditions prior to performing MPRA experiments in a new cell type. When working with hard-to-transfect cell types, MPRA signals can be boosted by pre-selecting transfected cells. The pMPRA vector series includes variants that constitutively express a truncated cell surface marker that can be used to physically enrich for transfected cells prior to RNA isolation (for example, Addgene IDs 49350 and 49351).

Declarações

The authors have nothing to disclose.

Acknowledgements

עבודה זו נתמכה על ידי הקרן הלאומי לחקר גנום אדם במכון המחקר של המכון הלאומי לבריאות בפרס מספר R01HG006785.

Materials

Oligonucleotide library synthesis	Agilent, CustomArray or other OLS vendors	custom	If using OLS construction method
pMPRA1	Addgene	49349	MPRA plasmid backbone
pMPRAdonor1	Addgene	49352	luc2 ORF donor plasmid
TE 0.1 Buffer (10 mM Tris-HCl, 0.1 mM EDTA, pH 8.0)	Generic	n/a	OLS buffer
Novex TBE-Urea Gels, 10%	Life Technologies	EC6875BOX	PAGE purification of OLS products
Novex TBA-Urea Sample Buffer	Life Technologies	LC6876	PAGE purification of OLS products
SYBR Gold Nucleic Acid Gel Stain	Life Technologies	S-11494	PAGE purification of OLS products
Micellula DNA Emulsion & Purification Kit	EURx/CHIMERx	3600-01	Library amplification by emulsion PCR
Herculase II Fusion DNA Polymerase	Agilent	600675	Polymerase for emulsion PCR
SfiI	New England Biolabs	R0123S	Library cloning with pMPRA vectors
KpnI-HF	New England Biolabs	R3142S	Library cloning with pMPRA vectors
XbaI	New England Biolabs	R0145S	Library cloning with pMPRA vectors
T4 DNA Ligase (2,000,000 units/ml)	New England Biolabs	M0202T	Library cloning with pMPRA vectors
One Shot TOP10 Electrocomp E. coli	Life Technologies	C4040-50	Library cloning with pMPRA vectors
LB agar and liquid media with carbenicllin	Generic	n/a	Growth media for cloning
E-Gel EX Gels 1%	Life Technologies	G4010-01	Library verification and purification
E-Gel EX Gels, 2%	Life Technologies	G4010-02	Library verification and purification
MinElute Gel Extraction Kit	Qiagen	28604	Library and backbone purification
EndoFree Plasmid Maxi Kit	Qiagen	12362	Library DNA isolation
Cell culture media	n/a	n/a	Experiment-specific
Transfection reagents	n/a	n/a	Experiment-specific
MicroPoly(A)Purist Kit	Life Technologies	AM1919	mRNA isolation
TURBO DNA-free Kit	Life Technologies	AM1907	Plasmid DNA removal
SuperScript III First-Strand Synthesis System	Life Technologies	18080-051	cDNA synthesis
PfuUltra II Hotstart PCR Master Mix	Agilent	600850	Polymerase for Tag-Seq PCR
Primers (see text)	IDT	custom	PAGE purify Tag-Seq primers

Referências

Kinney, J., Murugan, A., Callan, C. G., Cox, E. C. Using deep sequencing to characterize the biophysical mechanism of a transcriptional regulatory sequence. Proceedings of the National Academy of Sciences USA. 107 (20), 9158-9163 (2010).
Melnikov, A., et al. Systematic dissection and optimization of inducible enhancers in human cells using a massively parallel reporter assay. Nature Biotechnology. 30 (3), 271-277 (2012).
Patwardhan, R. P., Lee, C., Litvin, O., Young, D. L., Pe’er, D., Shendure, J. High-resolution analysis of DNA regulatory elements by synthetic saturation mutagenesis. Nature Biotechnology. 27 (12), 1173-1175 (2009).
Patwardhan, R. P., et al. Massively parallel functional dissection of mammalian enhancers in vivo. Nature Biotechnology. 30 (3), 265-270 (2012).
Arnold, C. D., Gerlach, D., Stelzer, C., Boryń, &. #. 3. 2. 1. ;. M., Rath, M., Stark, A. Genome-wide quantitative enhancer activity maps identified by STARR-seq. Science (New York, N. Y.). 339 (6123), 1074-1077 (2013).
Kheradpour, P., et al. Systematic dissection of regulatory motifs in 2000 predicted human enhancers using a massively parallel reporter assay. Genome Research. 23 (5), 800-811 (2013).
White, M. A., Myers, C. A., Corbo, J. C., Cohen, B. A. Massively parallel in vivo enhancer assay reveals that highly local features determine the cis -regulatory function of ChIP-seq peaks. Proceedings of the National Academy of Sciences USA. 110 (29), 11952-11957 (2013).
Mogno, I., Kwasnieski, J. C., Cohen, B. A. Massively parallel synthetic promoter assays reveal the in vivo effects of binding site variants. Genome Research. 23 (11), 1908-1915 (2013).
Schütze, T., et al. A streamlined protocol for emulsion polymerase chain reaction and subsequent purification. Analytical Biochemistry. 410 (1), 155-157 (2011).
Panne, D., Maniatis, T., Harrison, S. C. An atomic model of the interferon-beta enhanceosome. Cell. 129 (6), 1111-1123 (2007).

Play Video

PDF

DOI

DOWNLOAD MATERIALS LIST

Citar este artigo

Melnikov, A., Zhang, X., Rogov, P., Wang, L., Mikkelsen, T. S. Massively Parallel Reporter Assays in Cultured Mammalian Cells. J. Vis. Exp. (90), e51719, doi:10.3791/51719 (2014).