를 사용하여 폐렴 구균 식민지에서 생균제의 효과를 조사<em> 체외</em> 준수의 분석
Summary
체외에서 준수의 분석은 세포 단층 상피하는 등 폐렴 구균 식민지를 억제하기위한 프로 바이오 틱의 사용과 같은 잠재적 인 개입을 조사하기 위해 폐렴 구균의 부착을 연구하는 데 사용할 수 있습니다.
Abstract
비 인두의 상피에 폐렴 구균 (폐렴 구균)의 준수는 식민지가 발생할 수 있습니다합니다. 체외 준수의 분석이 세포를 상피 폐렴 구균의 부착을 연구하는 데 사용할 수있는 폐렴 및 중이염 등의 폐렴 구균 감염을위한 전제 조건으로 간주됩니다 단층과 같은 프로 바이오 틱의 사용과 같은 잠재적 인 개입을 조사하는 폐렴 구균 식민지을 억제 할 수 있습니다. 여기에 설명 된 프로토콜은 (때때로 HEP-2 세포로 지칭) 인간 상피 세포주 CCL-23 폐렴 구균의 부착에 생균제 스트렙토 코커스 살리 바리우스의 영향을 조사하기 위해 사용된다. 분석은 세 가지 주요 단계를 포함한다 : 상피 세포와 박테리아 세포의 1) 준비, 세포 단층 상피 박테리아의 2) 또한, 실행 가능한 횟수 (시리얼 희석 도금) 또는 정량 실시간 PCR (qPCR에 의한 부착 폐렴 구균의 3) 검출 ). 이 절반hnique은 비교적 간단하고 조직 문화 설정 이외의 특수 장비를 필요로하지 않습니다. 분석은 다른 생균제 종 및 / 또는 폐렴 구균 군체의 잠재적 억제제를 시험하는데 사용될 수 있고 쉽게 폐렴 구균 부착 및 침윤에 관한 다른 과학 문제를 해결하기 위해 수정 될 수있다.
Introduction
연쇄상 구균 폐렴 (폐렴 구균)는 폐렴, 중이염, 수막염 등의 감염을 일으킬 수있는 그람 양성 세균이다. 그것은 저소득 국가 어린이 매년 1 5 세 미만 어린이의 약 80 죽음에 책임이있는 질병의 주요 원인입니다. 폐렴 구균은 종종 어린이의 비 인두에서 수행됩니다. 이 식민지는 일반적으로 자각 증상이없는 것으로 간주되어 있지만, 그것은 폐렴 구균 감염을 앞에 인간의 인구 2의 박테리아를위한 저수지 역할을한다. 폐렴 구균 결합되는 예방 접종이 효과적으로 백신에 포함 된 혈청 형의 운송을 줄일 수 있습니다. 그러나, 90 폐렴 구균 혈청 형에, 그리고 예방 접종은 백신 혈청 형의 제거가 nonvaccine 혈청 형 3에 의한 운송과 질병의 상승 뒤에된다 혈청 형의 교체로 이어질 수 있습니다. 또한, 약간의 위험이 높은 집단에서, 폐렴 구균식민지는 종종 이전에 첫 번째 백신 투여 량 4.5의 관리에, 초기 생활에서 발생합니다. 최근, 프로바이오틱스의 사용은 폐렴 식민 6,7을 억제하는 추가의 전략으로서 제안되었다. 체외 부착 분석법은 폐렴 구균 부착 8,9를 검사하는데 사용되어왔다. 이러한 분석은 폐렴 구균 준수 (10)의 프로 바이오 틱 유산균 rhamnosus GG (LGG)의 영향을 조사하기 위해 적용되었다.
LGG 유용한 유산균 이외에, 스트렙토 코커스 살리 바리우스, 구강 공통 상주 인해 잠재적 체외 (11) 내에 폐렴 구균 및 다른 호흡기 병원체를 억제하는 능력의 정착에 호흡기 대한 잠재적 생균제로서 연구되어왔다 – 13. 여기에 제시된 프로토콜은 S.의 효과를 조사하기 위해 사용되는 접착 분석을 설명 폐렴 구균 준수에 살리 바리우스 K12인간의 상피 세포 라인 CCL-23. 성장과 준수 속성을 분리 10,14 사이에 실질적으로 다를 수있는 분석에 사용하기 전에, 폐렴 구균 균주는 준수의 기능을 평가 하였다. 폐렴 구균과 S.의 성장 곡선 살리 바리우스는 (OD, 그림 1) 광학 밀도 중반 로그 단계 및 추정 농도 (콜로니 형성 단위 또는 CFU / ㎖)을 결정하기 위해 수행되었다. 그것은 각각의 분석에서 사용하기 전에 분리를 위해 가능한 수와 OD로 성장을 검사하는 것이 좋습니다. 이 분석은 표준 조직 배양 시설 및 장비 모든 실험실에서 수행 할 수 있습니다. 이 프로토콜에서, S의 3 회에의 영향 살리 바리우스 이전 S.의 준수에 대한 폐렴 구균의 추가로 1 시간을 관리 폐렴 PMP843, 비 인두 면봉에서 파생 된 혈청 형 19F 캐리지 분리가 검사됩니다. 부착 폐렴 구균을 정량화하는 두 가지 방법이 제시되어 있습니다 억제 혈액 한천에 도금내 가능한 수, DNA 추출 및 qPCR에 (15)에 의해 폐렴 구균 리타 유전자의 검출. 기본적인 부착 분석 프로토콜은 쉽게 여러 복용량 또는 프로바이오틱스의 투여 시간을 시험하기 위하여 변형 될 수 있고, 또한 다른 균주 또는 종으로 사용될 수있다.
Protocol
Representative Results
Discussion
이 분석의 중요한 부분은 S.의 적절한 농도를 추가하고 섹션 3.1.7 및 3.1.12에 살리 바리우스와 폐렴 구균. 농도는 OD의 수치를 사용하여 추정되지만 플레이트 다음날 계산 될 때까지 정확한 접종이 결정되지 않습니다. 이러한 이유로, 우리는 중간 로그 위상을 식별하고 OD하여 농도를 추정을 지원하기 위해 분석에서 사용 된 모든 세균 균주에 대해 시간 OD 및 균수 (CFU / ㎖)를 측정하기 ?…
Declarações
The authors have nothing to disclose.
Acknowledgements
이 작품은 머독 아동 연구소와 빅토리아 정부의 운영 인프라 지원 프로그램에서 자금에 의해 지원되었다.
Materials
| Minimum Essential Media (MEM) | Thermo Fisher Scientific | SH30244.01 | ||
| Fetal Bovine Serum (FBS) | Thermo Fisher Scientific | SH30084.03 | ||
| T-75 Flask | Nunc | 156472 | ||
| CCL-23 cells | ATCC | CCL-23 | ||
| Trypsin | Life Technologies | 15090046 | ||
| 24-well cell culture plate | Nunc | 142475 | ||
| Horse blood agar (HBA) plates | Oxoid | PP2001 | Sheep blood agar plates also acceptable | |
| Todd-Hewitt Broth | Oxoid | CM0189 | ||
| Yeast Extract | Beckton Dickinson | 212750 | ||
| Digitonin | Sigma-Aldrich | D141-100MG | ||
| Disposable cuvettes | Kartell | 1938 | ||
| Heparin | Pfizer | 2112105 | comes in sterile ampules at 5,000IU/5mL | |
| sterile spreader | Technoplas | S10805050 | alternatively, a glass spreader can be dipped in 96% ethanol and flame sterilized before each use | |
| Lysozyme | Sigma-Aldrich | L6876 | ||
| Mutanolysin | Sigma-Aldrich | M9901 | ||
| Proteinase K | Qiagen | 19133 | ||
| SDS 20% solution | Ambion | AM9820 | ||
| RNase A | Qiagen | 19101 | ||
| QIAamp DNA mini-kit (250) | Qiagen | 51306 | ||
| LytA F primer | Sigma-Aldrich | Custom made | 5' -> 3' sequence ACGCAATCTAGCAGATGAAGCA | |
| LytA R primer | Sigma-Aldrich | Custom made | 5' -> 3' sequence TCGTGCGTTTTAATTCCAGCT | |
| LytA probe | Eurogentec | Custom made | 5' -> 3' sequence Cy5-TGCCGAAAACGCTTGATACAGGGAG-BHQ3, alternative fluorophores can be used | |
| Nuclease free water | Ambion | AM9906 | ||
| Brilliant III Ultra Fast QPCR mastermix | Agilent Technologies | 600880 | ||
| Thermo-Fast 96 Detection plate | Thermo Fisher Scientific | AB-1100 | ||
| Ultra clear qPCR cap strips | Thermo Fisher Scientific | AB-0866 | ||
| Mx3005 QPCR System | Agilent Technologies | 401449 | ||
| * alternative sources are available for most/all products listed | ||||
Referências
- O’Brien, K. L., et al. Burden of disease caused by Streptococcus pneumoniae in children younger than 5 years: global estimates. Lancet. 374, 893-902 (2009).
- Bogaert, D., de Groot, R., Hermans, P. W. M. Streptococcus pneumoniae colonisation: the key to pneumococcal disease. Lancet Infect. Dis. 4 (04), 144-154 (2004).
- Weinberger, D. M., Malley, R., Lipsitch, M. Serotype replacement in disease after pneumococcal vaccination. Lancet. 378 (10), 1962-1973 (2011).
- Jacoby, P., et al. Modelling the co-occurrence of Streptococcus pneumoniae with other bacterial and viral pathogens in the upper respiratory tract. Vaccine. 25, 2458-2464 (2007).
- Kwambana, B., Barer, M., Bottomley, C., Adegbola, R., Antonio, M. Early acquisition and high nasopharyngeal co-colonisation by Streptococcus pneumoniae and three respiratory pathogens amongst Gambian new-borns and infants. BMC Infect. Dis. 11, (2011).
- Licciardi, P. V., et al. Protecting against pneumococcal disease: critical interactions between probiotics and the airway microbiome. PLoS Pathog. 8, (2012).
- Popova, M., et al. Beneficial effects of probiotics in upper respiratory tract infections and their mechanical actions to antagonize pathogens. J. Appl. Microbiol. 113 (6), 1305-1318 (2012).
- Pracht, D., et al. PavA of Streptococcus pneumoniae modulates adherence, invasion, and meningeal inflammation. Infect. Immun. 73, 2680-2689 (2005).
- Adamou, J. E., Wizemann, T. M., Barren, P., Langermann, S. Adherence of Streptococcus pneumoniae to human bronchial epithelial cells (BEAS-2B). Infect. Immun. 66, 820-822 (1998).
- Wong, S. S., et al. Inhibition of Streptococcus pneumoniae adherence to human epithelial cells in vitro by the probiotic Lactobacillus rhamnosus GG. BMC Res. Notes. 6 (1), 135 (2013).
- Wescombe, P. A., Heng, N. C. K., Burton, J. P., Chilcott, C. N., Tagg, J. R. Streptococcal bacteriocins and the case for Streptococcus salivarius as model oral probiotics. Future Microbiol. 4, 819-835 (2009).
- Di Pierro, F., Adami, T., Rapacioli, G., Giardini, N., Streitberger, C. Clinical evaluation of the oral probiotic Streptococcus salivarius K12 in the prevention of recurrent pharyngitis and/or tonsillitis caused by Streptococcus pyogenes in adults. Expert. Opin. Biol. Ther. 13 (3), 339-343 (2013).
- Fiedler, T., et al. Protective mechanisms of respiratory tract streptococci against Streptococcus pyogenes biofilm formation and epithelial cell infection. Appl. Environ. Microbiol. 79, 1265-1276 (2013).
- Slotved, H. C., Satzke, C. In vitro growth of pneumococcal isolates representing 23 different serotypes. BMC Res. Notes. 6, 10-1186 (2013).
- Carvalho, M. d. G. S., et al. Evaluation and improvement of real-time PCR assays targeting lytA, ply, and psaA genes for detection of pneumococcal DNA. J. Clin. Microbiol. 45, 2460-2466 (2007).
- Tonnaer, E. L. G. M., et al. Involvement of glycosaminoglycans in the attachment of pneumococci to nasopharyngeal epithelial cells. Microbes Infect. 8, 316-322 (2006).
- Smith-Vaughan, H., et al. Measuring nasal bacterial load and its association with otitis media. BMC Ear Nose Throat Disord. 6, (2006).
- Letourneau, J., Levesque, C., Berthiaume, F., Jacques, M., Mourez, M. In vitro assay of bacterial adhesion onto mammalian epithelial cells. J. Vis. Exp. , (2011).
