Summary

Инженерные и эволюции Синтетическая адено-связанный вирус (AAV) генной терапии векторы с помощью ДНК семьи Перетасовка

Published: April 02, 2012
doi:

Summary

Мы показываем основные техники молекулярной инженерии и развиваться синтетические адено-ассоциированные вирусные (ААВ) вектора генной терапии с помощью ДНК семьи перетасовки. Кроме того, мы предоставляем общие принципы и характерные примеры для отбора и анализа отдельных химерных капсид с улучшенными свойствами на клетки-мишени в культуре или в организме мышей.

Abstract

Adeno-associated viral (AAV) vectors represent some of the most potent and promising vehicles for therapeutic human gene transfer due to a unique combination of beneficial properties1. These include the apathogenicity of the underlying wildtype viruses and the highly advanced methodologies for production of high-titer, high-purity and clinical-grade recombinant vectors2. A further particular advantage of the AAV system over other viruses is the availability of a wealth of naturally occurring serotypes which differ in essential properties yet can all be easily engineered as vectors using a common protocol1,2. Moreover, a number of groups including our own have recently devised strategies to use these natural viruses as templates for the creation of synthetic vectors which either combine the assets of multiple input serotypes, or which enhance the properties of a single isolate. The respective technologies to achieve these goals are either DNA family shuffling3, i.e. fragmentation of various AAV capsid genes followed by their re-assembly based on partial homologies (typically >80% for most AAV serotypes), or peptide display4,5, i.e. insertion of usually seven amino acids into an exposed loop of the viral capsid where the peptide ideally mediates re-targeting to a desired cell type. For maximum success, both methods are applied in a high-throughput fashion whereby the protocols are up-scaled to yield libraries of around one million distinct capsid variants. Each clone is then comprised of a unique combination of numerous parental viruses (DNA shuffling approach) or contains a distinctive peptide within the same viral backbone (peptide display approach). The subsequent final step is iterative selection of such a library on target cells in order to enrich for individual capsids fulfilling most or ideally all requirements of the selection process. The latter preferably combines positive pressure, such as growth on a certain cell type of interest, with negative selection, for instance elimination of all capsids reacting with anti-AAV antibodies. This combination increases chances that synthetic capsids surviving the selection match the needs of the given application in a manner that would probably not have been found in any naturally occurring AAV isolate. Here, we focus on the DNA family shuffling method as the theoretically and experimentally more challenging of the two technologies. We describe and demonstrate all essential steps for the generation and selection of shuffled AAV libraries (Fig. 1), and then discuss the pitfalls and critical aspects of the protocols that one needs to be aware of in order to succeed with molecular AAV evolution.

Protocol

1. Подготовка плазмиды наборы Кодирование AAV капсида Гены Для облегчения рутинной подготовки достаточного количества различных AAV капсида (крышка) гены последующим перетасовка ДНК, первоначально субклон этих генов в общем плазмиды позвоночника. Важно включают идентичные фл…

Discussion

Здесь мы выделили существенные экспериментальные шаги и рекомендации по AAV капсида инженерных через ДНК семьи перетасовки и эволюции в клетках или в животных. В сущности, эти протоколы являются стандартными версиями процедуры мы впервые сообщили в поле AAV в 2008 году 3. В то время ка…

Declarações

The authors have nothing to disclose.

Acknowledgements

Авторы выражают благодарность выдающимся поддержку своей лаборатории, членов команды и работы кластера передового опыта CellNetworks в Гейдельбергском университете, а также Чика и Хайнц Шаллер (CHS) фундамент. Мы понимаем, что молекулярная эволюция AAV с помощью ДНК перетасовки семья стала очень активной области с нашей первой публикации три года назад, и поэтому извинения всем авторам соответствующих публикаций, работа которых не может быть заключено в кавычки здесь из-за нехватки места.

Materials

Name of the reagent Company Catalogue number
DNase I Invitrogen 18068-015
Polyethylenimine (PEI) Sigma-Aldrich 408727
Restriction enzymes NEB Various
T4 DNA Ligase NEB M0202T
Gel extraction kit Qiagen 28704
Phusion II polymerase Kit Finnzymes (NEB) F-540S
HotStar Hifi polymerase Kit Qiagen 202602
DMSO Finnzymes (NEB) F-540S (part of kit)
EDTA (25 mM) Invitrogen 18068-015 (part of kit)
Tris Roth 4855.2
Ampicilin sodium salt Roth K029.2
dNTPs (10 mM, 100 μl) Invitrogen 18427013
Iodixanol (OptiPrep) Axis-shield 1114739
Phenolred Merck 107241
Plasmid mega prep kit Qiagen 12181
Ultracentrifuge Beckman-Coulter Optima L90K
Quick-Seal centrifuge tubes Beckman-Coulter 342414
Electroporation unit Bio-Rad GenePulserXcell
Thermal cycler Eppendorf Vapo Protect
Heating block BIOER MB-102
Fluorescence microscope Olympus IX81
FACS analyser Beckman-Coulter Cytomics FC500 MLP
MegaX DH10B T1R cells Invitrogen C640003
Benzonase Merck 101695
Adenovirus-5 ATCC VR-5
pBlueScript II KS(+) plasmid Stratagene 212207
cap5F (Pac I site in yellow, cap5-specific sequences in bold):
GACTCTTAATTAACAGGTATGTCTTTTGTTGATCACCCTCC
IDTDNA Custom primer
cap5R (Asc I site in green, cap5-specific sequences in bold):
GTGAGGGCGCGCCTTAAAGGGGTCGGGTAAGGTATC
IDTDNA Custom primer

Referências

  1. Grimm, D., Kay, M. A. From virus evolution to vector revolution: use of naturally occurring serotypes of adeno-associated virus (AAV) as novel vectors for human gene therapy. Curr. Gene Ther. 3, 281-304 (2003).
  2. Grimm, D. Production methods for gene transfer vectors based on adeno-associated virus serotypes. Methods. 28, 146-157 (2002).
  3. Grimm, D. In vitro and in vivo gene therapy vector evolution via multispecies interbreeding and retargeting of adeno-associated viruses. J. Virol. 82, 5887-5911 (2008).
  4. Muller, O. J. Random peptide libraries displayed on adeno-associated virus to select for targeted gene therapy vectors. Nat. Biotechnol. 21, 1040-1046 (2003).
  5. Perabo, L. In vitro selection of viral vectors with modified tropism: the adeno-associated virus display. Mol. Ther. 8, 151-157 (2003).
  6. Zolotukhin, S., Potter, M., Hauswirth, W. W., Guy, J., Muzyczka, N. A “humanized” green fluorescent protein cDNA adapted for high-level expression in mammalian cells. J. Virol. 70, 4646-4654 (1996).
  7. Wobus, C. E. Monoclonal antibodies against the adeno-associated virus type 2 (AAV-2) capsid: epitope mapping and identification of capsid domains involved in AAV-2-cell interaction and neutralization of AAV-2 infection. J. Virol. 74, 9281-9293 (2000).
  8. Grimm, D. Fatality in mice due to oversaturation of cellular microRNA/short hairpin RNA pathways. Nature. 441, 537-541 (2006).
  9. Nakai, H. Unrestricted hepatocyte transduction with adeno-associated virus serotype 8 vectors in mice. J. Virol. 79, 214-224 (2005).
  10. Koerber, J. T., Jang, J. H., Schaffer, D. V. DNA shuffling of adeno-associated virus yields functionally diverse viral progeny. Mol. Ther. 16, 1703-1709 (2008).
  11. Li, W. Engineering and selection of shuffled AAV genomes: a new strategy for producing targeted biological nanoparticles. Mol. Ther. 16, 1252-1260 (2008).
  12. Ward, P., Walsh, C. E. Chimeric AAV Cap sequences alter gene transduction. Virology. 386, 237-248 (2009).
  13. Yang, L. A myocardium tropic adeno-associated virus (AAV) evolved by DNA shuffling and in vivo selection. Proc. Natl. Acad. Sci. U.S.A. 106, 3946-3951 (2009).
  14. Perabo, L. Combinatorial engineering of a gene therapy vector: directed evolution of adeno-associated virus. J. Gene. Med. 8, 155-162 (2006).
  15. Maheshri, N., Koerber, J. T., Kaspar, B. K., Schaffer, D. V. Directed evolution of adeno-associated virus yields enhanced gene delivery vectors. Nat. Biotechnol. 24, 198-204 (2006).
  16. Wu, Z., Asokan, A., Samulski, R. J. Adeno-associated virus serotypes: vector toolkit for human gene therapy. Mol. Ther. 14, 316-327 (2006).
  17. Kwon, I., Schaffer, D. V. Designer gene delivery vectors: molecular engineering and evolution of adeno-associated viral vectors for enhanced gene transfer. Pharm. Res. 25, 489-499 (2008).
  18. Perabo, L., Huber, A., Marsch, S., Hallek, M., Buning, H. Artificial evolution with adeno-associated viral libraries. Comb. Chem. High. Throughput. Screen. 11, 118-126 (2008).
  19. McCarty, D. M., Monahan, P. E., Samulski, R. J. Self-complementary recombinant adeno-associated virus (scAAV) vectors promote efficient transduction independently of DNA synthesis. Gene Ther. 8, 1248-1254 (2001).

Play Video

Citar este artigo
Kienle, E., Senís, E., Börner, K., Niopek, D., Wiedtke, E., Grosse, S., Grimm, D. Engineering and Evolution of Synthetic Adeno-Associated Virus (AAV) Gene Therapy Vectors via DNA Family Shuffling. J. Vis. Exp. (62), e3819, doi:10.3791/3819 (2012).

View Video