JoVE Journal > Biochemistry
Summary
Abstract
Introduction
Protocol
Results
Discussion
Disclosures
Acknowledgements
Materials
References
Please note that all translations are automatically generated. Click here for the English version.
생화학

Kombination von Röntgen-Kristallographie mit kleinen Winkel Röntgenstreuung, unstrukturierte Regionen der Nsa1 aus S. Cerevisiae zu modellieren

Published: January 10, 2018
doi:
10.3791/56953
, ,
1Signal Transduction Laboratory, National Institutes of Environmental Health Sciences, Department of Health and Human Services,National Institutes of Health

Summary

Diese Methode beschreibt die Klonen, Ausdruck und Reinigung von rekombinanten Nsa1 zur Strukturaufklärung durch Röntgen-Kristallographie und kleine Winkel Röntgenstreuung (SAXS) und gilt für die Hybrid-Strukturanalyse von anderen Proteinen mit beiden bestellt und Domänen ungeordnet.

Abstract

Bestimmung der Struktur der Ribosom Versammlung Faktor Nsa1 von Saccharomyces Cerevisiae (S. Cerevisiae) in voller Länge ist schwierig wegen der ungeordneten und Protease labil C-Terminus des Proteins. Dieses Manuskript beschreibt die Methoden um rekombinante Nsa1 aus S. Cerevisiae für Baustatik durch Röntgen-Kristallographie und SAXS zu reinigen. Röntgen-Kristallographie wurde eingesetzt, um die Struktur der wohlgeordneten WD40 N-terminale Domäne des Nsa1 zu lösen, und dann SAXS wurde verwendet, um die Struktur des C-Terminus des Nsa1 in Lösung zu beheben. Lösung Streuung Daten wurden von in voller Länge Nsa1 in Lösung. Die theoretische Streuung Amplituden wurden von der hochauflösenden Kristallstruktur des Geschäftsfeldes WD40 berechnet, und dann offenbart eine Kombination des steifen Körpers und ab-initio -Modellierung der C-Terminus des Nsa1. Durch diesen Hybridansatz wurde die quartäre Struktur des gesamten Proteins rekonstruiert. Die hier vorgestellten Methoden sollten in der Regel für die Hybrid-Strukturaufklärung anderer Proteine, bestehend aus einer Mischung aus strukturierten und unstrukturierten Domänen gelten.

Introduction

Ribosomen sind große Ribonucleoprotein Maschinen, die die wesentliche Rolle der Übersetzung von mRNA in Proteine in allen lebenden Zellen durchführen. Ribosomen bestehen aus zwei Untereinheiten, die in einem aufwändigen Verfahren bezeichnet Ribosom Biogenese1,2,3,4hergestellt werden. Eukaryotische Ribosom Versammlung stützt sich auf die Hilfe von Hunderten von wesentlichen ribosomale Montage Faktoren2,3,5. Nsa1 (Nop7 verbunden 1) ist ein eukaryotische Ribosom Versammlung-Faktor, der speziell für die Produktion der großen ribosomalen Untereinheit6erforderlich ist, und ist bekannt als WD-Wiederholung, 74 (WDR74) in höheren Organismen7enthält. WDR74 hat gezeigt, dass für die Blastozyste Bildung in Mäusen8erforderlich und der WDR74-Promoter ist häufig in Krebs Zellen9mutiert. Die Funktion und die genauen Mechanismen der Nsa1/WDR74 im Ribosom Versammlung sind jedoch noch weitgehend unbekannt. Um zu beginnen, die Rolle der Nsa1/WDR74 während der Reifung eukaryotische Ribosom aufzudecken, wurden mehrere strukturelle Analysen durchgeführt, einschließlich Röntgen-Kristallographie und kleinen Winkel x-ray Scattering (SAXS)10.

Röntgen-Kristallographie, Kernresonanzspektroskopie (NMR), Elektronenmikroskopie und SAXS sind alle wichtigen Techniken für makromolekulare Struktur zu studieren. Größe, Form, Verfügbarkeit und Stabilität der Makromoleküle Einflüsse der Strukturbiologie Methode, für die ein bestimmtes Makromolekül wird am besten sein, geeignet, jedoch kombiniert mehrere Techniken durch einen sogenannten “Hybrid”-Ansatz ist immer ein immer vorteilhaft Werkzeug11. Insbesondere sind Röntgen-Kristallographie und SAXS kraftvoll und ergänzende Methoden zur Strukturaufklärung von Makromolekülen12.

Kristallographie bietet hochauflösende atomare Strukturen von kleinen Molekülen bis hin zu großen zellulären Maschinerie wie das Ribosom und führte zu zahlreichen Durchbrüchen in das Verständnis der biologischen Funktionen von Proteinen und anderen Makromoleküle13. Darüber hinaus nutzt Struktur basierende Wirkstoff-Design die Kraft der Kristallstrukturen zum molekularen Andocken von Berechnungsmethoden, Droge-Entdeckung und Entwicklung14eine kritische Dimension hinzuzufügen. Trotz seiner breiten Anwendbarkeit sind flexibel und ungeordneten Systeme schwer zu beurteilen von Kristallographie da Kristall Verpackung behindert kann oder Elektron Dichte Karten möglicherweise unvollständig oder von schlechter Qualität. Umgekehrt ist SAXS ein lösungsorientierter und mit niedriger Auflösung struktureller Ansatz in der Lage, flexible Systeme, die ungeordneten Schlingen und Termini bis hin zu intrinsisch ungeordneten Proteine12,15,16, zu beschreiben. Wenn man bedenkt, dass es kompatibel mit einer breiten Palette von Teilchen Größen12, kann SAXS synergistisch arbeiten mit Kristallographie, biologische Fragestellungen erweitert, die durch strukturelle Studien behandelt werden können.

Nsa1 eignet sich für ein Hybrid-strukturellen Ansatz, denn es enthält eine gut strukturierte WD40 Domäne gefolgt von einer funktionalen, aber flexible C-Terminus nicht Röntgen-Kristallographie Methoden zugänglich ist. Es folgt ein Protokoll für das Klonen, Ausdruck und Reinigung von S. Cerevisiae Nsa1 für Hybrid Strukturaufklärung durch Röntgen-Kristallographie und SAXS. Dieses Protokoll kann angepasst werden, um die Strukturen von anderen Proteinen zu studieren, die aus einer Kombination von geordneten und ungeordneten Regionen bestehen.

Protocol

(1) rekombinante Protein-Produktion und Reinigung des Nsa 1 Nsa1 Expression Plasmid Design und Klonen Erhalten oder S. Cerevisiae genomischen DNA zu kaufen. PCR verstärken die Zielsequenzen Nsa1 (Nsa1FL, Rückstände 1-463) und C-terminalen abgeschnitten Nsa1 (Nsa1ΔC, Rückstände 1-434) mit entsprechenden Grundierungen mit genomische DNA isoliert von S. Cerevisiae und eine Schmelztemperatur von ca. 60 ° C mit einer Verlängerung von 1-2 min. Die fol…

Representative Results

Nsa1 war PCR verstärkt aus S. Cerevisiae genomischer DNA und subcloned in einen Vektor mit einer N-terminalen 6 X-Histidin Affinität Tag gefolgt von MBP und ein TEV Protease-Website. Nsa1 verwandelte sich in E. Coli BL21(DE3) Zellen und hohe Erträge der Proteinexpression wurden nach Induktion mit IPTG und Wachstum bei 25 ° C über Nacht (Abb. 1A). Nsa1 war Affinität auf immobilisierte Kobalt Affinität Harz, gefolgt von MBP Spaltung mit…

Discussion

Unter Verwendung dieses Protokolls, wurde rekombinante Nsa1 aus S. Cerevisiae für strukturelle Studien durch Röntgen-Kristallographie und SAXS generiert. Nsa1 war brav in Lösung und in mehreren Kristallformen kristallisiert. Bei der Optimierung dieser Kristalle entdeckte man, dass der C-Terminus des Nsa1 empfindlich auf Protease-Abbau war. Die hohe Auflösung, orthorhombic Kristallform konnte nur mit C-terminale abschneiden Varianten der Nsa1, wahrscheinlich dupliziert werden, weil der flexible C-Terminus des…

Disclosures

The authors have nothing to disclose.

Acknowledgements

Beugung im Südosten regionale kooperative Zugriffsteam (SER-CAT) 22-ID und 22-BM Beamlines an der Advanced Photon Source (APS), Argonne National Laboratory Daten. Die SAXS Daten wurden auf die SIBYLLEN Strahlrohr im Voraus Licht Quelle (ALS), Lawrence Berkeley National Laboratory. Wir möchten den Mitarbeitern bei der SIBYLLEN Strahlrohr für ihre Hilfe bei remote-Datenerfassung und-Verarbeitung danken. Wir sind dankbar für die National Institute of Environmental Health Sciences (NIEHS) Mass Spectrometry Forschung und Selbsthilfegruppe für Hilfe bei der Bestimmung der Protein-Domänengrenzen. Diese Arbeit wurde durch das uns nationale Institute der Gesundheit intramuralen Forschungsprogramm unterstützt; US National Institute of Environmental Health Sciences (NIEHS) (ZIA ES103247, R. E. S.) und den kanadischen Institutes of Health Research (CIHR, 146626, M.C.P). Verwendung der APS wurde unterstützt durch das US Department of Energy, Office of Science, Büro der grundlegenden Energiewissenschaften unter Vertragsnr. W-31-109-DEU-38. Verwendung von Advanced Light Source (ALS) wurde unterstützt durch die Direktor des Office of Science, Büro von Energie Grundlagenwissenschaften, des US-Department of Energy unter Vertragsnr. DE-AC02-05CH11231. Zusätzlicher Unterstützung für die SIBYLLEN SAXS Strahlrohr kommt aus dem National Institute of Health Projekt MINOS (R01GM105404) und eine High-End-Instrumentierung Grant S10OD018483. Wir möchten auch Danke Andrea Moon und Dr. Sara Andres für ihre kritischen Lektüre des Manuskripts.

Materials

Molecular Cloning of Nsa1
pMBP2 parallel vector Sheffield et al, Protein Expression and Purification 15, 34-39 (1999) We used a modified version of pMBP2 which included an N-terminal His-tag (pHMBP)
S. cerevisiae genomic DNA ATCC 204508D-5
Primers for cloning Nsa1
SC_Nsa1_FLFw IDT CGC CAA AGG CCT
ATGAGGTTACTAGTCAGCTGTGT
GGATAG
SC_Nsa1_FLRv IDT AATGCAGCGGCCGCTCAAATTTT
GCTTTTCTTACTGGCTTTAGAAGC
AGC
SC_Nsa1_DeltaCFw IDT GGGCGCCATGGGATCCATGAGG
TTACTAGTCAGCTGTGTGG
SC_Nsa1_DeltaCRv IDT GATTCGAAAGCGGCCGCTTAAAC
CTTCCTTTTTTGCTTCCC
Recombinant Protein Production and Purification of Nsa1
Escherichia coli BL21 (DE3) Star Cells Invitrogen C601003
pMBP- NSA1 and various truncations Lo et al., 2017
Selenomethionine Molecular Dimensions MD12-503B
IPTG, Dioxane-Free Promega V3953
EDTA Free Protease Inhibitor Cocktail Sigma-Aldrich 4693159001
Sodium Chloride Caledon Laboratory Chemicals 7560-1-80
Magnesium Chloride hexahydrate Sigma-Aldrich M2670
Tris Buffer, 1 M pH7.5 KD Medical RGF-3340
Glycerol Invitrogen 15514-029
beta-mercaptoethanol Sigma M6250
1M Imidazole, pH 8.0 Teknova I6980-06
Talon Affinity Resin Clonetech 635503
Amicon Ultra 15 mL Centrifugal Filter (MWCO 10K) Millipore UFC901024
HiLoad 16/600 Superdex 200 Prep Grade Gel Filtration Column GE-Healthcare 28989335
TEV Protease Prepared by NIEHS Protein Expression Core Expression plasmid provided by NCI (Tropea et al. Methods Mol Biology, 2009)
4-15% Mini-PROTEAN TGX Precast Protein Gels BioRad 456-8056
Crystallization, Proteolytic Screening
Crystal Screen Hampton Research HR2-110
Crystal Screen 2 Hampton Research HR2-112
Salt Rx Hampton Research HR2-136
Index  Screen Hampton Research HR2-144
PEG/Ion Screen Hampton Research HR2-139
JCSG+ Molecular Dimensions MD1-37
Wizard Precipitant Synergy  Molecular Dimensions MD15-PS-T
Swissci 96-well 3-drop UVP sitting drop plates TTP Labtech 4150-05823
3inch Wide Crystal Clear Sealing Tape Hampton Research HR4-506
Proti-Ace Kit Hampton Research HR2-429
PEG 1500 Molecular Dimensions MD2-100-6
PEG 400 Molecular Dimensions MD2-100-3
HEPES/sodium hydroxide pH 7.5 Molecular Dimensions MD2-011-
Sodium Citrate tribasic Molecular Dimensions MD2-100-127
22 mm x 0.22 mm Siliconized Coverslides Hampton Research HR3-231
24 Well Plates with sealant (VDX Plate with Sealant) Hampton Research HR3-172
 18 mM Mounted Nylon Loops (0.05 mm to 0.5 mM) Hampton Research HR4-945, HR4-947, HR4-970, HR4-971
Seed Bead Kit Hampton Research HR2-320
Magnetic Crystal Caps Hampton Research HR4-779
Magnetic Cryo Wand Hampton Research HR4-729
Cryogenic Foam Dewar Hampton Research HR4-673
Crystal Puck System MiTeGen M-CP-111-021
Full Skirt 96 well Clear Plate VWR 10011-228
AxyMat Sealing Mat VWR 10011-130
Equipment
UVEX-m JAN Scientific, Inc.
Nanodrop Lite Spectrophotometer Thermo-Fisher
Mosquito Robot TTP Labtech
Software/Websites
HKL2000 Otwinoski and Minor, 1997
Phenix Adams et al., 2010
Coot Emsley et al., 2010
ATSAS Petoukhov et al., 2012 https://www.embl-hamburg.de/biosaxs/atsas-online/
Scatter Rambo and Tainer, 2013
Pymol The PyMOL Molecular Graphics System, Version 1.8 Schrödinger, LLC.
BUNCH Petoukhov and Svergun, 2005
CRYSOL Svergun et al, 1995
PRIMUS Konarev et al, 2003
EOM Tria et al, 2015
DOWNLOAD MATERIALS LIST

References

  1. Thomson, E., Ferreira-Cerca, S., Hurt, E. Eukaryotic ribosome biogenesis at a glance. J Cell Sci. 126 (Pt 21), 4815-4821 (2013).
  2. Woolford, J. L., Baserga, S. J. Ribosome biogenesis in the yeast Saccharomyces cerevisiae. 유전학. 195 (3), 643-681 (2013).
  3. Kressler, D., Hurt, E., Bassler, J. A Puzzle of Life: Crafting Ribosomal Subunits. Trends Biochem Sci. , (2017).
  4. Tomecki, R., Sikorski, P. J., Zakrzewska-Placzek, M. Comparison of preribosomal RNA processing pathways in yeast, plant and human cells – focus on coordinated action of endo- and exoribonucleases. FEBS Lett. , (2017).
  5. Kressler, D., Hurt, E., Bassler, J. Driving ribosome assembly. Biochim Biophys Acta. 1803 (6), 673-683 (2010).
  6. Kressler, D., Roser, D., Pertschy, B., Hurt, E. The AAA ATPase Rix7 powers progression of ribosome biogenesis by stripping Nsa1 from pre-60S particles. J Cell Biol. 181 (6), 935-944 (2008).
  7. Hiraishi, N., Ishida, Y., Nagahama, M. AAA-ATPase NVL2 acts on MTR4-exosome complex to dissociate the nucleolar protein WDR74. Biochem Biophy Res Co. 467 (3), 534-540 (2015).
  8. Maserati, M., et al. Wdr74 is required for blastocyst formation in the mouse. PLoS One. 6 (7), e22516 (2011).
  9. Weinhold, N., Jacobsen, A., Schultz, N., Sander, C., Lee, W. Genome-wide analysis of noncoding regulatory mutations in cancer. Nat Genet. 46 (11), 1160-1165 (2014).
  10. Lo, Y. H., Romes, E. M., Pillon, M. C., Sobhany, M., Stanley, R. E. Structural Analysis Reveals Features of Ribosome Assembly Factor Nsa1/WDR74 Important for Localization and Interaction with Rix7/NVL2. Structure. 25 (5), 762-772 (2017).
  11. Lander, G. C., Saibil, H. R., Nogales, E. Go hybrid: EM, crystallography, and beyond. Curr Opin Struc Biol. 22 (5), 627-635 (2012).
  12. Putnam, C. D., Hammel, M., Hura, G. L., Tainer, J. A. X-ray solution scattering (SAXS) combined with crystallography and computation: defining accurate macromolecular structures, conformations and assemblies in solution. Q Rev Biophys. 40 (3), 191-285 (2007).
  13. Jaskolski, M., Dauter, Z., Wlodawer, A. A brief history of macromolecular crystallography, illustrated by a family tree and its Nobel fruits. FEBS J. 281 (18), 3985-4009 (2014).
  14. Zheng, H., et al. X-ray crystallography over the past decade for novel drug discovery – where are we heading next?. Expert Opin Drug Dis. 10 (9), 975-989 (2015).
  15. Kikhney, A. G., Svergun, D. I. A practical guide to small angle X-ray scattering (SAXS) of flexible and intrinsically disordered proteins. FEBS Lett. 589 (19 Pt A), 2570-2577 (2015).
  16. Bernado, P., Mylonas, E., Petoukhov, M. V., Blackledge, M., Svergun, D. I. Structural characterization of flexible proteins using small-angle X-ray scattering. J Am Chem Soc. 129 (17), 5656-5664 (2007).
  17. Sheffield, P., Garrard, S., Derewenda, Z. Overcoming expression and purification problems of RhoGDI using a family of “parallel” expression vectors. Protein Expres Purif. 15 (1), 34-39 (1999).
  18. Doublie, S. Preparation of selenomethionyl proteins for phase determination. Methods Enzymol. 276, 523-530 (1997).
  19. Tropea, J. E., Cherry, S., Waugh, D. S. Expression and purification of soluble His(6)-tagged TEV protease. Methods Mol Biol. 498, 297-307 (2009).
  20. Wlodawer, A., Minor, W., Dauter, Z., Jaskolski, M. Protein crystallography for aspiring crystallographers or how to avoid pitfalls and traps in macromolecular structure determination. FEBS J. 280 (22), 5705-5736 (2013).
  21. Otwinowski, Z., Minor, W. Processing of X-ray diffraction data collected in oscillation mode. Macromolecular Crystallography, Pt A. 276, 307-326 (1997).
  22. Adams, P. D., et al. PHENIX: a comprehensive Python-based system for macromolecular structure solution. Acta Crystallogr D. 66 (Pt 2), 213-221 (2010).
  23. Winn, M. D., et al. Overview of the CCP4 suite and current developments. Acta Crystallogr D. 67 (Pt 4), 235-242 (2011).
  24. Terwilliger, T. C., et al. Decision-making in structure solution using Bayesian estimates of map quality: the PHENIX AutoSol wizard. Acta Crystallographica Section D. 65, 582-601 (2009).
  25. Emsley, P., Lohkamp, B., Scott, W. G., Cowtan, K. Features and development of Coot. Acta Crystallogr D. 66 (Pt 4), 486-501 (2010).
  26. Afonine, P. V., et al. Towards automated crystallographic structure refinement with phenix.refine. Acta Crystallogr D. 68 (Pt 4), 352-367 (2012).
  27. McCoy, A. J. Solving structures of protein complexes by molecular replacement with Phaser. Acta Crystallogr D. 63 (Pt 1), 32-41 (2007).
  28. McCoy, A. J., et al. Phaser crystallographic software. J Appl Crystallogr. 40 (Pt 4), 658-674 (2007).
  29. Dyer, K. N., et al. High-throughput SAXS for the characterization of biomolecules in solution: a practical approach. Methods Mol Biol. 1091, 245-258 (2014).
  30. Forster, S., Apostol, L., Bras, W. Scatter: software for the analysis of nano- and mesoscale small-angle scattering. J Appl Crystallogr. 43, 639-646 (2010).
  31. Petoukhov, M. V., et al. New developments in the ATSAS program package for small-angle scattering data analysis. J Appl Crystallogr. 45, 342-350 (2012).
  32. Konarev, P. V., Volkov, V. V., Sokolova, A. V., Koch, M. H. J., Svergun, D. I. PRIMUS: a Windows PC-based system for small-angle scattering data analysis. J Appl Crystallogr. 36, 1277-1282 (2003).
  33. Svergun, D. I. Determination of the Regularization Parameter in Indirect-Transform Methods Using Perceptual Criteria. J Appl Crystallogr. 25, 495-503 (1992).
  34. Rambo, R. P., Tainer, J. A. Accurate assessment of mass, models and resolution by small-angle scattering. Nature. 496 (7446), 477-481 (2013).
  35. Petoukhov, M. V., Svergun, D. I. Global rigid body modeling of macromolecular complexes against small-angle scattering data. Biophys J. 89 (2), 1237-1250 (2005).
  36. Tria, G., Mertens, H. D., Kachala, M., Svergun, D. I. Advanced ensemble modelling of flexible macromolecules using X-ray solution scattering. IUCrJ. 2 (Pt 2), 207-217 (2015).
  37. Svergun, D., Barberato, C., Koch, M. H. J. CRYSOL – A program to evaluate x-ray solution scattering of biological macromolecules from atomic coordinates. J Appl Crystallogr. 28, 768-773 (1995).
  38. . The PyMOL Molecular Graphics System Version 1.8 Available from: https://pymol.org (2015)
  39. Pelikan, M., Hura, G. L., Hammel, M. Structure and flexibility within proteins as identified through small angle X-ray scattering. Gen Physiol Biophys. 28 (2), 174-189 (2009).
  40. Deller, M. C., Kong, L., Rupp, B. Protein stability: a crystallographer’s perspective. Acta Crystallogr F. 72 (Pt 2), 72-95 (2016).
  41. Hinsen, K. Structural flexibility in proteins: impact of the crystal environment. Bioinformatics. 24 (4), 521-528 (2008).
  42. Shtykova, E. V., et al. Structural analysis of influenza A virus matrix protein M1 and its self-assemblies at low pH. PLoS One. 8 (12), e82431 (2013).
  43. Mallam, A. L., et al. Solution structures of DEAD-box RNA chaperones reveal conformational changes and nucleic acid tethering by a basic tail. Proc Natl Acad Sci U S A. 108 (30), 12254-12259 (2011).
  44. Papaleo, E., et al. The Role of Protein Loops and Linkers in Conformational Dynamics and Allostery. Chem Rev. 116 (11), 6391-6423 (2016).
  45. Rozycki, B., Boura, E. Large, dynamic, multi-protein complexes: a challenge for structural biology. J Phys Condens Matter. 26 (46), 463103 (2014).
  46. Schlundt, A., Tants, J. N., Sattler, M. Integrated structural biology to unravel molecular mechanisms of protein-RNA recognition. Methods. 118, 119-136 (2017).
  47. Thompson, M. K., Ehlinger, A. C., Chazin, W. J. Analysis of Functional Dynamics of Modular Multidomain Proteins by SAXS and NMR. Methods Enzymol. 592, 49-76 (2017).

Tags

X-ray CrystallographySmall Angle X-ray Scattering (SAXS)Structural AnalysisProtein StructureRecombinant ProteinUnstructured RegionsNsa1S. CerevisiaeHybrid Structural AnalysisProtein FunctionProtein DynamicsProtein AggregationPurificationAffinity ChromatographyGel FiltrationSDS-PAGETEV ProteaseCentrifugal Filtration

Play Video
PDF
DOI
DOWNLOAD MATERIALS LIST
Cite This Article
Lo, Y., Pillon, M. C., Stanley, R. E. Combining X-Ray Crystallography with Small Angle X-Ray Scattering to Model Unstructured Regions of Nsa1 from S. Cerevisiae. J. Vis. Exp. (131), e56953, doi:10.3791/56953 (2018).
Download Citation
Reprints and Permissions

View Video

✖

To prove you're not a robot, please enter the text in the image below

CAPTCHA Image
Play CAPTCHA Audio
Refresh Image