여기에서는 생체 내에서 분자 내 및 분자간 RNA-RNA 상호 작용의 게놈 전체 매핑을 가능하게하는 P soralen crosslinked, Ligated 및 S – selected Hysbrids (SL)의 S equencing 방법을 자세히 설명합니다. SPLASH는 효모, 박테리아 및 인간을 포함한 유기체의 RNA 상호 작용을 연구하는 데 적용 할 수 있습니다.
RNA가 어떻게 상호 작용 하는지를 아는 것은 세포에서 RNA 기반의 유전자 조절을 이해하는 데 중요합니다. microRNA-mRNA 상호 작용과 같은 RNA-RNA 상호 작용의 예가 유전자 발현을 조절하는 것으로 나타 났지만 RNA 상호 작용이 세포에서 일어나는 전체 범위는 아직 알려지지 않았습니다. RNA 상호 작용을 연구하기위한 이전의 방법은 주로 특정 단백질 또는 RNA 종과 상호 작용하는 RNA의 부분 집합에 초점을 맞추었다. 여기에서는 P soralen crosslinked, Ligated 및 S elected H ybrids (SPLASH)라는 이름의 방법을 상세히 설명합니다.이 방법을 사용하면 생체 내 에서 RNA 상호 작용 을 편파적으로 캡처 할 수 있습니다. SPLASH는 생체 내 교차 결합, 근접 결합 및 높은 처리량 시퀀싱을 사용하여 분자 내 및 분자간 RNA 염기쌍 파트너를 세계적으로 확인합니다. SPLASH는 박테리아, 효모 및 인간 세포를 포함한 다른 유기체에 적용 할 수 있습니다.다양한 세포 환경에서 RNA 조직의 역 동성을 이해하는 데 도움이되는 다양한 세포 조건을 제공합니다. 전체 실험 SPLASH 프로토콜은 완료하는 데 약 5 일이 걸리고 계산 워크 플로는 완료하는 데 약 7 일이 걸립니다.
거대 분자들이 서로 어떻게 접히고 상호 작용하는지 연구하는 것은 세포에서의 유전자 조절을 이해하는 열쇠입니다. 지난 수십 년간 DNA와 단백질이 유전자 조절에 어떻게 기여하는지에 대한 많은 노력이 집중되어 왔지만, 유전자 발현의 전사 후 조절에 관해서는 알려진 바가 상대적으로 적다. RNA는 선형 서열과 2 차 및 3 차 구조 모두에서 정보를 전달한다. 생체 내에서 자신과 다른 사람과 쌍을 이루는 능력이 중요합니다. 고 처리량 RNA 2 차 구조 탐색에서의 최근의 진보는 트랜스 크립 풋 2 , 3 , 4 , 5 , 6 , 7 , 8 , howe에서 이중 및 단일 가닥 영역의 위치에 대한 가치있는 통찰을 제공했다페어링 상호 작용 파트너에 대한 ver 정보가 아직 많이 누락되었습니다. transcriptome에서 어떤 RNA 서열이 다른 RNA 영역과 상호 작용 하는지를 결정하기 위해, 우리는 전구 쌍방향 정보가 필요합니다.
쌍방향의 RNA 상호 작용을 전지구하고 공평하지 않은 방식으로 매핑하는 것은 전통적으로 중요한 과제였습니다. CLASH 9 , hiCLIP 10 및 RAP 11 과 같은 이전의 접근법은 대규모 방식으로 RNA 상호 작용을 확인하는 데 사용되지만 이러한 기술은 일반적으로 특정 단백질 또는 RNA 종과 상호 작용하는 RNA의 하위 집합에 대해 RNA 염기쌍을 매핑합니다. 세계적 RNA 상호 작용을 연구하는 최근의 연구에는 생체 내에서 RNA 상호 작용 을 안정화시키지 않는 생체 내 상호 작용의 부분 집합 만 포착 할 수있는 RPL 12 방법이 포함된다. 이러한 어려움을 극복하기 위해 우리와 다른 사람들은 게놈 전반에 걸친 공평한 전략을 개발하여p RNA interactomes 를 in vivo 에서 사용하여 crosslinker psoralen 13 , 14 , 15 의 변형 된 버전을 사용했습니다. 이 프로토콜에서는 생체 내에서 염기쌍 결합 RNA를 가교 결합시킨 비 오티 닐화 된 소 랄렌을 사용하여 근접 결합 및 높은 처리량 시퀀싱을 수행 한 P soralen crosslinked, Ligated 및 Sided H ybrids (SPLASH)의 S equencing을 수행하기위한 세부 사항을 설명합니다. 게놈 전체 RNA base-pairing 파트너를 확인하십시오 ( 그림 1 ).
이 원고에서 배양 된 접착 세포,이 경우에는 HeLa 세포를 사용하여 SPLASH를 수행하는 단계를 설명합니다. 동일한 프로토콜은 포유 동물 현탁액 및 효모 및 박테리아 세포에 쉽게 적용될 수 있습니다. 간략하게, HeLa 세포를 바이오 티 닐화 된 소 랄렌으로 처리하고 생체 내에서 상호 작용하는 RNA 염기 쌍을 가교 결합시키기 위해 365 nm에서 조사 하였다. 그런 다음 RNA를 세포에서 추출하고 스트렙 트 아비딘 (streptavidin) 구슬을 사용하여 가교 결합 영역을 강화하고 단편화합니다. 인터랙 팅 RNA 단편은 근접 결합을 사용하여 함께 결찰되고 심층 시퀀싱을위한 cDNA 라이브러리로 만들어진다. 시퀀싱시 키메라 RNA는 transcriptome / genome에 매핑되어 서로 쌍을 이루는 RNA 상호 작용 영역을 식별합니다. 우리는 SPLASH를 이용하여 snoRNA, lncRNA 및 mRNA와 같은 RNA의 다양한 부류에서 분자 내 및 분자간 RNA 염기 쌍 형성을 비롯하여 구조 조직 및 상호 작용 패턴을 엿볼 수있는 효모 및 다른 인간 세포 에서 생체 내 에서 수천 건의 RNA 상호 작용을 확인했습니다 세포에서 RNA의.
여기서 우리는 게놈 전체에서 pair-wise RNA 상호 작용을 확인하는 방법 인 SPLASH의 실험 및 계산 워크 플로우에 대해 자세히 설명합니다. 우리는 박테리아, 효모 및 인간 문화에서 SPLASH를 성공적으로 활용했으며 전략이 다양한 세포 상태에서 다양한 유기체에 광범위하게 적용될 수있을 것으로 기대합니다. 프로토콜의 중요한 단계 중 하나는 하류 공정에 적합한 물질을 가지기 위해 적어도 20 μg의 가?…
The authors have nothing to disclose.
Wan 연구원과 Nagarajan 연구원에게 유익한 토론에 감사드립니다. N.Nagarajan은 A * STAR의 자금 지원을받습니다. Y.Wan은 A * STAR 및 Society in Science-Branco Weiss Fellowship의 지원을받습니다.
1 Kb Plus DNA Ladder | Life Technologies Holdings Pte Ltd | 10787026 | DNA ladder |
10 bp DNA ladder | Life Technologies Holdings Pte Ltd | 10821-015 | DNA ladder |
20 % SDS solution | First BASE | BUF-2052-1L | |
20x SSC | First BASE | BUF-3050-20X1L | |
3.0 M Sodium Acetate Solution | First BASE | BUF-1151-1L-pH5.2 | Required for nucleic acid precipitation |
40% Acrylamide/Bis Solution, 19:1 | Bio-Rad | 1610145 | TBE Urea gel component |
Ambion Buffer Kit | Life Technologies Holdings Pte Ltd | AM9010 | |
Ammonium Persulfate, Molecular Grade | Promega | V3131 | TBE Urea gel component |
Bromophenol Blue | Sigma-Aldrich | B0126-25G | |
Chloroform | Merck | 1.02445.1000 | RNA extraction |
Single strand DNA ligase | Epicentre | CL9025K | CircLigase II ssDNA Ligase |
Centrifuge tube filters | Sigma-Aldrich | CLS8160-96EA | Costar Spin-X centrifuge tube filters |
D5628-1G DIGITONIN CRYSTALLINE | Sigma-Aldrich | D5628-1G | For cell treatment |
Dark Reader Transilluminator | Clare Chemical Research | Dark Reader DR89X Transilluminator | Blue light transilluminator |
DNA Gel Loading Dye (6X) | Life Technologies Holdings Pte Ltd | R0611 | Required for agarose gel electroporation |
Dulbecco's Modified Eagle Medium | Pan BioTech | P04-03500 | For Hela cell culture |
Streptavidin magnetic beads | Life Technologies Holdings Pte Ltd | 65002 | Dynabeads MyOne Streptavidin C1 |
Magnetic stand for 15ml tubes | Life Technologies Holdings Pte Ltd | 12301D | DynaMag-15 |
Magnetic stand for 15ml tubes | Life Technologies Holdings Pte Ltd | 12321D | DynaMag-2 |
ThermoMixer | Eppendorf | 5382 000.015 | Eppendorf ThermoMixer C |
Biotinylated psoralen | Life Technologies Holdings Pte Ltd | 29986 | EZ-Link Psoralen-PEG3-Biotin |
F8T5/BL | Hitachi | F8T5/BL | 365 nm UV bulb |
Fetal Bovine Serum | Life Technologies Holdings Pte Ltd | 10270106 | Components of Hela medium |
Formamide | Promega | H5052 | Component in hybridization buffer |
G8T5 | Sankyo-Denki | G8T5 | 254 nm UV bulb |
Glycogen | Life Technologies Holdings Pte Ltd | 10814010 | Required for nucleic acid precipitation |
Nanodrop | Life Technologies Holdings Pte Ltd | Nanodrop 2000 | Spectrophotometer for nucleic acidquantification |
Nuclease free water | First BASE | BUF-1180-500ml | |
Penicillin Streptomycin | Life Technologies Holdings Pte Ltd | 15140122 | Components of Hela medium |
High-Fidelity DNA polymerase (2x) | Life Technologies Holdings Pte Ltd | F531L | Phusion High-Fidelity PCR Master Mix with HF Buffer (2x) |
Primers Set 1 | New England Biolabs | E7335L | PCR primers |
DNA Gel Extraction Kit | QIAgen | 28106 | QIAquick Gel Extraction Kit |
Fluorometric Quantification kit | Life Technologies Holdings Pte Ltd | Q32854 | Qubit dsDNA HS Assay Kit |
RNA clean up kit | Qiagen | 74106 | RNeasy Mini Kit Silica-membrane column |
Rnase Inhibitor | Life Technologies Holdings Pte Ltd | AM2696 | SUPERase In |
Reverse transcriptase | Life Technologies Holdings Pte Ltd | 18080400 | SuperScript III First-Strand Synthesis SuperMix |
Nucleic Acid Gel Stain | Life Technologies Holdings Pte Ltd | S11494 | SYBR GOLD NUCLEIC ACID 500 UL |
T4 Polynucleotide Kinase | New England Biolabs | M0201L | End repair enzyme |
T4 RNA Ligase 1 | New England Biolabs | M0204L | Enzyme for proximity ligation |
T4 RNA Ligase 2, truncated KQ | New England Biolabs | M0373L | Enzyme for adaptor ligation |
Temed | Bio-Rad | 1610801 | TBE Urea gel component |
Guanidinium thiocyanate-phenol-chloroform | Life Technologies Holdings Pte Ltd | 15596018 | TRIzol® Reagent for RNA extraction |
Urea | First BASE | BIO-2070-5kg | |
UV crosslinker | Stratagene | 400072 | UV Stratalinker 1800 |
UV Transilluminator | UVP | 95-0417-01 | For visualizing of bands |
Xylene Cyanol FF | Sigma-Aldrich | X4126-10G | |
DNA cleanup it | Zymo Research | D4004 | Zymo DNA concentrator-5 |
List of software required | |||
FastQC software | 0.11.4 | http://www.bioinformatics.babraham.ac.uk/projects/fastqc/ | |
SeqPrep software | 1.0.7 | https://github.com/jstjohn/SeqPrep | |
BWA software | 0.7.12 | http://bio-bwa.sourceforge.net/ | |
SAMTOOLS software | 1.2.1 | http://www.htslib.org/ | |
PULLSEQ software | 1.0.2 | https://github.com/bcthomas/pullseq | |
STAR software | 2.5.0c | https://github.com/alexdobin/STAR | |
rem_dups.py PYTHON script | PYTHON 2.7.11 | https://github.com/CSB5/splash/tree/master/src | |
find_chimeras.py PYTHON script | PYTHON 2.7.11 | https://github.com/CSB5/splash/tree/master/src | |
pickJunctionReads.awk AWK script | AWK GNU 4.1.2 | https://github.com/CSB5/splash/tree/master/src | |
Buffer composition | |||
Elution buffer: | |||
0.3 M sodium acetate | |||
Lysis Buffer: | |||
50 mM Tris-Cl pH 7.0 | |||
10 mM EDTA | |||
1% SDS | |||
Always add Superase-in fresh before use except when washing beads | |||
Proteinase K Buffer | |||
100 mM NaCl | |||
10 mM TrisCl pH 7.0 | |||
1 mM EDTA | |||
0.5% SDS | |||
Hybridization Buffer | |||
750 mM NaCl | |||
1% SDS | |||
50 mM Tris-Cl pH 7.0 | |||
1 mM EDTA | |||
15% formamide (store in the dark at 4 °C) | |||
Always add Superase-in fresh before use | |||
2x SSC Wash Buffer | |||
2x NaCl and Sodium citrate (SSC) (diluted from 20x SSC Invitrogen stock) | |||
0.5% SDS | |||
2X RNA fragmentation buffer | |||
18mM MgCl2 | |||
450mM KCl | |||
300mM Tris-CL pH 8.3 | |||
2x RNA loading Dye: | |||
95% Formamide | |||
0.02% SDS | |||
0.02% bromophenol blue | |||
0.01% Xylene Cyanol | |||
1mM EDTA | |||
3' RNA adapter sequence | 5rAppCTGTAGGCACCATCAAT/3ddC | ||
RT primer sequence | AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC/iSp18/CACTCA/iSp18/TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG |