JoVE Journal > Immunology and Infection
Summary
Abstract
Introduction
Protocol
Results
Discussion
Disclosures
Acknowledgements
Materials
References
Please note that all translations are automatically generated. Click here for the English version.
면역학 및 감염병학

-Loop gemedieerde Isothermisch Amplification (LAMP) Testen voor de Species-specifieke detectie van<em> Eimeria</em> Dat Kippen infecteren

Published: February 20, 2015
doi:
10.3791/52552
, , ,
1Department of Pathology and Pathogen Biology,Royal Veterinary College, London, 2BIOPHARM,Research Institute of Biopharmacy and Veterinary Drugs

Summary

Diagnosis of Eimeria infection in chickens remains demanding. Parasite morphology- and host pathology-led approaches are commonly inconclusive, while molecular approaches based on PCR have proven demanding in cost and expertise. The aim of this protocol is to establish loop-mediated isothermal amplification (LAMP) as a straightforward molecular diagnostic for eimerian infection.

Abstract

Eimeria species parasites, protozoa which cause the enteric disease coccidiosis, pose a serious threat to the production and welfare of chickens. In the absence of effective control clinical coccidiosis can be devastating. Resistance to the chemoprophylactics frequently used to control Eimeria is common and sub-clinical infection is widespread, influencing feed conversion ratios and susceptibility to other pathogens such as Clostridium perfringens. Despite the availability of polymerase chain reaction (PCR)-based tools, diagnosis of Eimeria infection still relies almost entirely on traditional approaches such as lesion scoring and oocyst morphology, but neither is straightforward. Limitations of the existing molecular tools include the requirement for specialist equipment and difficulties accessing DNA as template. In response a simple field DNA preparation protocol and a panel of species-specific loop-mediated isothermal amplification (LAMP) assays have been developed for the seven Eimeria recognised to infect the chicken. We now provide a detailed protocol describing the preparation of genomic DNA from intestinal tissue collected post-mortem, followed by setup and readout of the LAMP assays. Eimeria species-specific LAMP can be used to monitor parasite occurrence, assessing the efficacy of a farm’s anticoccidial strategy, and to diagnose sub-clinical infection or clinical disease with particular value when expert surveillance is unavailable.

Introduction

Global kip productie is tien keer in de afgelopen 50 jaar toegenomen met de derde wereld hosting bijna vier keer de uitbreiding getuige in de ontwikkelde wereld (www.faostat.org) . Als de relevantie van de productie van kippen tot de mondiale voedselzekerheid is inmiddels zo heeft ook het profiel van pathogenen die ernstige ziekte bij kippen kan veroorzaken. Een goed voorbeeld zijn de Eimeria soorten, alomtegenwoordige protozoaire parasieten die de darmziekte coccidiose 1 kan veroorzaken. Waar kippen worden gehouden één of meer Eimeria soorten zijn waarschijnlijk gemeenschappelijke 2-4 te zijn. In de ontwikkelde wereld Eimeria worden voornamelijk gecontroleerd door chemoprofylaxe, in dienst shuttle of rotatie programma's om de impact van de weerstand 5 minimaliseren. Levende vaccins worden ook gebruikt in systemen waar vogelwaarden voldoende is om de kosten te rechtvaardigen (bijv fokdieren, lagen en sommige vleeskuikens 5). Als een result van deze maatregelen klinische coccidiose is vaak goed onder controle, hoewel subklinische infectie is gebruikelijk 5. In de derde wereld vaccinatie is zeldzaam en drug aanvraag vaak minder goed op de hoogte. Bijgevolg subklinisch en klinische coccidiose is gebruikelijker en oefent een grote economische gevolgen 3.

Diagnose van eimerian infectie is van oudsher vertrouwd op laesie scoren post-mortem, hoewel zelfs de auteurs van de meest gebruikte scoresysteem merkte op dat voor sommige soorten "het lijkt twijfelachtig of een dergelijke procedure moet worden geprobeerd in ieder maar matig ernstige infecties" 6. Aanvullend bewijs kan worden verzameld door middel van microscopische detectie van de milieuvriendelijke resistente fase oocyst levenscyclus in faecale en strooisel monsters, hoewel overlappende morfologie kunnen alle beschamen, maar de expert 6,7. Moleculaire alternatieven met polymerase kettingreactie (PCR), willekeurig amplification van polymorfe DNA-PCR (RAPD-PCR) en kwantitatieve PCR-technologieën zijn beschikbaar voor maximaal 20 jaar 8-10 geweest, maar tot op heden hebben ze niet populair geworden. Relatieve kosten en de eis voor specialistische laboratorium apparatuur of verwerking hebben hun opname beperkt, ondanks de vaak subjectief en technisch veeleisende karakter van de oudere pathology- en-microscopie gebaseerde benaderingen 10,11. Dergelijke beperkingen kunnen in veel van de armere regio's van de wereld, zoals Zuid-Oost-Azië, waar de invloed van coccidiose op de armoede verhoudingsgewijs groter 12 kan worden overdreven. In reactie is er een duidelijke behoefte aan nieuwe eenvoudige en gevoelige, maar kosteneffectieve, Eimeria species-specifieke diagnostische assays.

Loop-gemedieerde isothermische amplificatie (LAMP) is een eenvoudige DNA-polymerase aangedreven techniek die kan amplificeren grote hoeveelheden DNA te bereiden. Belangrijker nog, LAMP maakt gebruik van een Bst DNA polymerase plaats van het Taq DNA polymerase vaak gebruikt bij PCR, waarbij DNA amplificatie vergemakkelijkt op één constante temperatuur zonder de noodzaak voor de temperatuurcycli 13,14. LAMP kunnen vatbaar zijn voor toepassing in zelfs de meest rudimentaire laboratorium of in het veld. Gekenmerkt door relatieve bestendigheid tegen vele PCR remmers, hoge gevoeligheid en specificiteit, zijn LAMP assays ontwikkeld voor een breed scala van pathogenen waaronder infectieuze bursitis virus, Clostridium perfringens en Cryptosporidium 15-17. In antwoord op de vraag naar nieuwe rendabele Eimeria soortspecifiek diagnose een panel van LAMP assays specifiek zijn voor elk van de zeven soorten Eimeria die kippen infecteren ontwikkeld 18. Aanvragen voor de nieuwe assays omvatten bewaking parasiet optreden, met name van belang gezien de vereniging van soorten zoals Eimeria maxima of Eimeria necatrix met slechte economische performance 3,4. Andere toepassingen zijn onder meer de beoordeling van de werkzaamheid van coccidiose strategie, diagnose van subklinische infectie of klinische ziekte en evaluatie van de risico's van Eimeria naar een boerderij van een boerderij.

Protocol

1. Template Voorbereiding OPMERKING: genomisch DNA matrijs vermoedelijk DNA afkomstig van één van de zeven soorten Eimeria die kippen infecteren bevatten, kunnen worden gebruikt als template voor LAMP gebaseerde identificatie Eimeria species. Intestinaal weefsel monsters voor veld diagnostische analyse moet worden verzameld tijdens routine postmortale zoals hier beschreven. Kies het onderdeel (of onderdelen) van de darm te testen. Zie tabel 1 voor een gids voor sample selectie van locaties en de Eimeria soorten die het meest waarschijnlijk aanwezig 18 en figuur 1 voor de soortspecifieke verspreidingsgebied en de locatie van de bemonstering locaties te zijn. LET OP: Dit is van groot belang, omdat Eimeria zijn met name host site specifiek. Elke soort dat kippen besmet wordt bepaald door het intestinale gebied dat gericht 19. De beslissing kan worden beïnvloed door eerdere ervaringen van de boerderij, interesse in één of more specifieke Eimeria soorten of andere diagnostische indicatoren 6. Accijnzen 5 cm of langere lengtes van de intestinale sectie (s) geselecteerd om te testen voor Eimeria met steriele schaar of een scalpel. Eventueel monsters worden voor verdere analyse in een fixeermiddel zoals bijvoorbeeld RNAlater 18 of 95% ethanol. OPMERKING: Bij opslag in ethanol het monster grondig uitwassen steriele tris-ethyleendiaminetetraazijnzuur (TE) buffer voor gebruik. Snij het monster geopend lengterichting, verwijder de meeste darminhoud (indien aanwezig) en schraap cellen uit de mucosale laag vrij met behulp van de rand van een steriele glazen microscoop dia of een ethanol / vlam gesteriliseerd schaar. Optioneel voor een samengevoegd monster omvatten cellen uit alle vier de soortspecifieke intestinale plaatsen in een enkele buis. Doe de geschraapt materiaal in een steriele 1,5 ml schroef-top microcentrifugebuis met 100 ul steriele TE-buffer inclusief 10% (w / v) Chelex 100 hars. Krachtig schudden elk monster gedurende 1 min. Zorg ervoor dat de schroef top is goed gesloten en vervolgens incubeer in een bad met kokend water gedurende 10 minuten. Na het koken kan elke monster afkoelen bij omgevingstemperatuur gedurende 1-2 min. Centrifuge elk monster met behulp van een microcentrifuge op topsnelheid (bv ~ 10.000 xg) gedurende 1 min. Verzamel 2 pl van de resulterende supernatant om template in elke LAMP assay uit te voeren. Eventueel zwembad meerdere intestinale plaats in een enkele buis naar een multi-site assay verschaffen. 2. Eimeria LAMP Primer Voorbereiding (pre-test) Bereid Eimeria LAMP primer voorraden voldoende voor 100 tests: Reconstitueer elke gevriesdroogde Eimeria LAMP primer door het toevoegen van moleculair-biologische kwaliteit water tot een concentratie van 100 uM (zoals opgegeven door de fabrikant). Indien niet opgegeven, berekent het volume van moleculair-biologische kwaliteit water nodig usinG de fysieke en moleculaire gewichten van elke primer. Pipetteer 60 ul moleculair-biologische kwaliteit van water in een aparte 0,5 ml flip-top microcentrifugebuis voor elke Eimeria soorten worden getest. Voeg primers FIP, BIP, F3, B3, LF en LB specifiek zijn voor de beoogde Eimeria species aan het water met de in tabel 2 volumes, waardoor een reeks van zeven species-specifieke primer mengsels. Kort vortex meng de primer oplossing, dan pols microfugebuizen en bevriezen totdat vereist. Bereid een LAMP reactie mastermix voor elke Eimeria soorten worden getest. Vermenigvuldig in tabel 3 delen door het aantal monsters en drie aan een positieve controle, negatieve controle en pipetteren reserve. Pipet in een 0,5 of 1,5 ml flip-top microcentrifugebuisje. 3. Eimeria LAMP Assay Pipetteer 23 ul Eimeria soortspecifieke Bst DNA polymerase / LAMP Mastermix in een 0.5 ml microcentrifugebuis. Voeg 2 pl DNA-template (opgesteld in paragraaf 1), het maken van een definitieve reactie volume van 25 pi. Voeg 2 pi Eimeria species-specifiek genomisch DNA een reactie (positieve controle). Voeg 2 pl moleculair-biologische kwaliteit water tot reactie (negatieve controle). OPMERKING: als soortspecifieke genomisch DNA niet beschikbaar is een eerdere positieve LAMP of standaard PCR-product kan worden gebruikt. Incubeer in een waterbad of hitteblok bij 62 ° C gedurende 30 min. Eventueel de-activeren Bst DNA polymerase door verwarming tot 80 ° C gedurende 10 min als de reactie niet zal onmiddellijk worden gelezen. 4. LAMP Assay Read-out Aan het einde van de incubatie beoordelen de kleur van elke reactie op het oog onder kunstlicht. Negatieve resultaten lijken roze tot violet van kleur, positieve resultaten lijken hemelsblauw 20. Optioneel, bevestigen de LAMP-test resultaat in een Laboratory van 5 ul LAMP reactieproduct mengen met 1 pl DNA gelbeladingsbuffer voor agarose gel elektroforese met een 2% agarosegel in 1 x Tris / boraat / EDTA (TBE) buffer, vooraf gekleurd met een nucleïnezuur kleurstof (5 gl per 50 ml agarose). Voeg 5 ul van een 1 Kb moleculaire grootte DNA-ladder naar baan 1 van de gel te fragment size berekening mogelijk te maken.

Representative Results

Assay validatie Tijdens validatie elk Eimeria soortspecifiek LAMP assay getest met een panel van zuiver DNA monsters die alle zeven soorten Eimeria dat de kip, en kip genomisch DNA als gastheer controle infecteren. Agarose gel-elektroforese werd gebruikt om elke assay lossen en aangetoond absolute soortspecificiteit zonder gastheer kruisreactiviteit 18. Vervolgens werd een tienvoudige seriële verdunningsreeks bereid met gezuiverde Eimeria tenella genomisch DNA onthulde een grens assay gevoeligheid van één tot tien genoomkopieën 18. Geen bovengrens werd bepaald met bereikt tot positieve resultaten en met de hoogste concentratie (100.000 exemplaren van het genoom) 18. Toepassing met veld monsters Monsters verzameld voor Eimeria testen zullen waarschijnlijk worden afgeleid van kippen dood gevonden, geruimd als gevolg van poor de gezondheid of geruimd voor sentinel gezondheidstoezicht, wat wijst op een waarschijnlijke steekproefgrootte van tussen de een en drie als onderdeel van een routine. Het testen van drie vogels verzameld van een Amerikaanse vleeskuikenbedrijf als onderdeel van een surveillance programma leverde drie sets van darmmonsters. Gerichte toepassing van de soortspecifieke LAMP assays, prioriteit de voorkeur intestinale gebieden voor elk Eimeria soorten (Tabel 1), toegestaan ​​visuele identificatie van eimerian infectie bij alle dieren getest met behulp Hydroxynaftolblauw blauw als indicator (Figuur 2A). De kleur bereikt met een negatieve LAMP reactie bij gebruik Hydroxynaftolblauw blauwe kan variëren van violet naar roze, maar altijd verschillend van de blauwe bereikt met een positief resultaat. Bevestiging met agarosegelelektroforese ontvangen vergelijkbare resultaten (Figuur 2B). Tijdens veld applicatie kan de gebruiker ervoor kiezen om het volledige scherm te passen tegen alle zeven soorten, of doel alleen die soorten geprioriteerd alsbelangrijk of bekend te circuleren op de boerderij of omgeving. Het falen van PCR gebaseerde benaderingen vestigen als diagnostica voor het optreden van Eimeria benadrukt de behoefte aan eenvoud nieuwe test. Terwijl LAMP biedt eenvoudigere voorbereiding en verwerking dan PCR, de eis om meerdere intestinale plaatsen per vogel testen blijft ontmoedigend. Productie van een samengevoegd DNA monster per vogel, die vervolgens kunnen worden getest met één of meer LAMP assays, waarschijnlijk aantrekkelijker zijn. Hetzelfde resultaat als wanneer elk intestinale locatie afzonderlijk verwerkt (Figuur 2 verwerkt een samengevoegd monster per vogel, die materiaal Van elk van de specifieke intestinale plaatsen in tabel 1 beschreven en samengevoegd voor DNA preparaat, testen alle zeven LAMP assays ontvangen vergeleken met figuur 3). <img alt="Figuur 1" src="/files/ftp_upload/52552/52552fig1.jpg" /> Figuur 1. Intestinale monsternemingspunten voor LAMP detectie van Eimeria soorten parasieten die kippen infecteren. De darm regio gericht door elk soort Eimeria wordt benadrukt door de gekleurde lijnen met de voorkeursplaatsen van bemonstering aangegeven door het cijfer tussen de gestippelde zwarte lijnen (E. acervulina: geel / 1, E. Brunetti: roze / 2, E. maxima: blauw / 3, E. mitis: oranje / 4, E. necatrix: rood / 5, E. praecox: groen / 6 en E. tenella: grijs / 7). Klik hier om een grotere versie van deze afbeelding te bekijken. Figuur 2. LAMP diagnose van eimerian infectie from drie commerciële slachtkippen. LAMP reacties opgelost met behulp van (A) Hydroxynaftolblauw blauw, waar een hemelsblauwe reactie was positief en een paars tot roze reactie was negatief, en (B) agarosegelelektroforese. De intestinale bemonsterde waren zoals weergegeven in Tabel 1 voor elke soort parasiet. A = E. acervulina, B = E. Brunetti, Ma = E. maxima, Mi = E. mitis, N = E. necatrix, P = E. praecox en T = E. tenella. Baan 1 bevatte de GeneRuler 1kb DNA-ladder. Klik hier om een grotere versie van deze afbeelding te bekijken. Figuur 3. LAMP diagnose van eimerian infectie met behulp van gepoolde monsters uit drie afzonderlijke commerciële slachtkippen. LAMP reacties opgelost met Hydroxynaftolblauw blauw, waar een hemelsblauwe reactie was positief en paars tot roze reactie was negatief. A = E. acervulina, B = E. Brunetti, Ma = E. maxima, Mi = E. mitis, N = E. necatrix, P = E. praecox en T = E. tenella. Klik hier om een grotere versie van deze afbeelding te bekijken. Monster website Eimeria species assay (waarschijnlijk) Twaalfvingerige darm (D) E. acervulina, E. praecox Jejunum / ileum * (J / I) E. maxima, E. necatrix Caeca (C) E. necatrix, E. tenella Ileum (TI) E. brunetti, E. mitis </tr> Samengevoegd monster (P) E. acervulina, E. brunetti, E. maxima, E. mitis, E. necatrix, E. praecox, E. tenella Tabel 1. Intestinale regiospecifieke selectie van kandidaat Eimeria soorten assays. De keuze van de regio bemonsteren varieert per Eimeria species zoals geïllustreerd in figuur 1. Gepoolde monsters omvatten materiaal vanuit alle vier specifieke plaatsen die vervolgens werden samengevoegd voor DNA-bereiding. Primer * De concentratie (uM) Volume (pl) Water – 60 Forward Inner Primer (FIP) 100 40 Achteruit Inner Primer (BIP) 100 40 Forward Outer Primer (F3) 100 10 Achteruit Outer Primer (B3) 100 10 Loop vooruit (LF) 100 20 Loop achteruit (LB) 100 20 Totaal 200 Tabel 2. Bereiding van een LAMP primer voormengsel. De componenten en verhoudingen nodig een primer voormengsel bereiden LAMP. Volumes getoond zijn voor 100 LAMP reacties. * Primer identiteiten zoals in de materialen en Barkway et al (2011) 18. Stock conc n Laatste reactie conc n Volume per reactie (pl) DDW – – 10.1 Thermopol buffer 10 x 1 x 2.5 MgSO4 100 mM 2 mM 0.5 Primermengsel * Tabel 2 2.5 dNTPs 25 mM 400 uM 0.4 Betaine 5 M 1 M 5 Hydroxynaftolblauw blauw 3 mM 120 uM 1 Bst DNA polymerase 8000 U / ml 8 U 1 Totaal 23 Tabel 3. Voorbereiding van een LAMP reactie mastermix. * Eimeria soortspecifiek.

Discussion

The Eimeria species-specific LAMP assays described in this paper offer a new diagnostic tool kit in support of effective control of coccidia and the disease coccidiosis. The outcomes of eimerian infection can include severe economic loss as well as seriously compromised bird welfare and increased susceptibility to colonisation by zoonotic pathogens21. Opportunities to monitor flocks for the occurrence of some, or all Eimeria species can provide early warning of a breakdown in anticoccidial control efficacy. Key advantages of LAMP include robust target specificity, resulting from the requirement for six different DNA sequence targets, as well as high sensitivity, boosted by the inclusion of loop primers13, although the qualitative, not quantitative nature of LAMP may be considered a limitation. It is not currently possible to discriminate low level parasite escape from routine chemoprophylaxis or live vaccine replication from unchecked eimerian replication. Nonetheless, the technical ease of the protocol and definitive readout offers considerable improvement over the existing specialist and frequently subjective pathology- and morphology-led approaches6,7. Each assay may be completed at a cost of ~£0.75 per sample, independent of labour and equipment set up expenses. Thus, LAMP assays are also more cost effective than other molecular diagnostics such as PCR, since they require an isothermal incubation with no need for specialist equipment.

For many years access to Eimeria genomic DNA as template has limited the development and application of molecular field diagnostics. The oocyst is the most readily accessible phase of the eimerian lifecycle, but routine DNA extraction requires laboratory facilities22. Other, more labile intestinal lifecycle stages require purification prior to DNA preparation to prevent PCR inhibition and a consequent loss of sensitivity23,24. The ability to extract eimerian DNA of a quality suitable for LAMP using equipment no more specialised than a microcentrifuge and a water bath, supplemented by inhibitor adsorption using chelex resin, now promotes the wider use of molecular biology in eimerian diagnostics. Intriguingly, the reported detection of quantitative PCR-measurable Eimeria DNA in intestinal tissue 20 days after the initiation of parasite infection, 11 days after the last detectable oocyst output, raises the suggestion that LAMP may be used to detect resolved parasite exposure as well as ongoing infection, even after any visible lesions may have been resolved25.

The relatively low cost and low technical requirements of LAMP Eimeria diagnostics can promote their application in the developing world where other more established approaches may not be available or appropriate. For this to be applicable each assay must be capable of detecting all strains which may be circulating within each region. While understanding of the genetic diversity prevailing among Eimeria species is limited26, the use of target sequences previously validated for use in quantitative PCR with strains from Africa, Asia, Europe and South America provides some evidence of conservation, supporting the utility of these LAMP assays around the world10.

Disclosures

The authors have nothing to disclose.

Acknowledgements

The work carried out in this study was supported in part by the Royal Veterinary College through the student research projects fund, as well as the Biotechnology and Biological Sciences Research Council and the Department for International Development (grant number BB/H009337/2). This manuscript has been assigned the reference PPB_00795 by the RVC.

Materials

Name Company Catalogue number Comments
RNAlater Ambion AM7024
Ethanol VWR Chemicals 20821.321 Caution, highly flammable
100 x Tris-EDTA (TE) buffer concentrate Sigma-Aldrich T9285
Chelex 100 resin Bio-Rad 142-1253
Molecular grade water Invitrogen 10977035
E. acervulina F3 Sigma-Aldrich VC00021 *CCTAACATTTCGCTTCACGGAC
E. acervulina B3 Sigma-Aldrich VC00021 *ATGAGCAAGTGGAACACCTTG
E. acervulina FIP Sigma-Aldrich VC00021 *AGAGCACAGTGGCAGTGC-AGCAGACAGCATGGCTTACCT
E. acervulina BIP Sigma-Aldrich VC00021 *GAAGACCCTCTGAAGAACGGA-CCTTCTCACCGCTTACCGG
E. acervulina LB Sigma-Aldrich VC00021 *TAAGGTTACACCCGTGGAGG
E. acervulina LF Sigma-Aldrich VC00021 *GCCATGCACAAAGCGACTT
E. brunetti F3 Sigma-Aldrich VC00021 *GGCCATCAAGTTCCATGAGC
E. brunetti B3 Sigma-Aldrich VC00021 *TCAACCTCCTGAGTGTGGTT
E. brunetti FIP Sigma-Aldrich VC00021 *GAAAATGCCTTCGTAGCTGCT-GCTGGGTACGGAGCGTCTT
E. brunetti BIP Sigma-Aldrich VC00021 *TACTTCCTAGGATCCATCCTCGC-AGTTTCGCTGCCGCCTC
E. brunetti LB Sigma-Aldrich VC00021 *GAAACGCTCGAACATGGC
E. brunetti LF Sigma-Aldrich VC00021 *CTTCTCCACAGACCCAGAGGT
E. maxima F3 Sigma-Aldrich VC00021 *ACTACGGAAAAGTGCGTAGCT
E. maxima B3 Sigma-Aldrich VC00021 *CCTTCCTCCCTTCTGAAAACTG
E. maxima FIP Sigma-Aldrich VC00021 *GAGTCACTGCTGATGTACCAAA
AG-GAACTATGCCGCTTTCCCCTG
E. maxima BIP Sigma-Aldrich VC00021 *AGAATGCGGATTTGTTAGCAGC-AGCAAGTCCAAGGTGTGTGTA
E. maxima LB Sigma-Aldrich VC00021 *CAAGCCTACGCGGACATC
E. maxima LF Sigma-Aldrich VC00021 *TTATGCAGCTGGGTCAACG
E. mitis F3 Sigma-Aldrich VC00021 *ACGATAGCCAAGACACGTAAGG
E. mitis B3 Sigma-Aldrich VC00021 *CCCCGTGATAAGAGTAGGAACA
E. mitis FIP Sigma-Aldrich VC00021 *CGCGGGTCGTGAGATTTAAATT
AT-GGAAGATCAGGACGGGCACT
E. mitis BIP Sigma-Aldrich VC00021 *GTTTCAGTTGATGAACAAGCGA
GA-TGCGCCTCTAGAATCAAGACG
E. mitis LB Sigma-Aldrich VC00021 *TCCATGCATCCCCTTGTT
E. mitis LF Sigma-Aldrich VC00021 *CGTGGGCACAGATTGATTC
E. necatrix F3 Sigma-Aldrich VC00021 *TGGCTTTCCCGCGTACC
E. necatrix B3 Sigma-Aldrich VC00021 *CGGCCCAACACAAAGACTG
E. necatrix FIP Sigma-Aldrich VC00021 *CGCTTGAGTTTTAAGCTATGCA
CA-GACCCAAGCAGCTCACCAA
E. necatrix BIP Sigma-Aldrich VC00021 *CGCCATGCCATTCAATGAACG-*GAGGCATACCGGCGTTGTC
E. necatrix LB Sigma-Aldrich VC00021 *GTCTGTAACTTGGGACGTTGT
E. necatrix LF Sigma-Aldrich VC00021 *GAACAGCCGGAGCCTCTC
E. praecox F3 Sigma-Aldrich VC00021 *GCCCTTGTATGTTGCTGTTTCT
E. praecox B3 Sigma-Aldrich VC00021 *GCGCACGAATCTGAATCACAC
E. praecox FIP Sigma-Aldrich VC00021 *ATCTCCTCAAAGACTTTCGCGT
A-GCGCTTGGCTATATCCATAGG
E. praecox BIP Sigma-Aldrich VC00021 *GCTCTCGTGGCATACTTGC-GCCAGGAGCCACTGATTGT
E. praecox LB Sigma-Aldrich VC00021 *GAATAGCATTGCCAGGTGG
E. praecox LF Sigma-Aldrich VC00021 *GTCCACTGTCATTAATATTGC
TGC
E. tenella F3 Sigma-Aldrich VC00021 *GCTTGTGAAGGTCAGCGTG
E. tenella B3 Sigma-Aldrich VC00021 *GCTGAGTCCATACGTACTTCCT
E. tenella FIP Sigma-Aldrich VC00021 *GCCACTGCTATGGAAAGTCAC
AC-CATAACTGGCATGCAGGGGT
E. tenella BIP Sigma-Aldrich VC00021 *GTTTGGCCCGAAAGTTGTGAA
GA-CGTCAGAAATTGCTGCCCAAT
E. tenella LB Sigma-Aldrich VC00021 *CGCATGTGCAGTTGAAGACA
E. tenella LF Sigma-Aldrich VC00021 *CCAAATGTATCTGCTAGTTATA
TTAACAAG
10 x ThermoPol reaction buffer New England Biolabs B9004S
MgSO4 Sigma-Aldrich M7506
dNTPs Promega U1330
Betaine solution (5 M) Sigma-Aldrich B0300
Bst polymerase New England Biolabs M0275S
Hydroxynaphthol blue Sigma-Aldrich 33936 Dissolved in molecular grade water.
UltraPure agarose Invitrogen 16500-500
10 x Tris/Borate/EDTA (TBE) buffer Invitrogen AM9863
Blue/Orange DNA loading dye (x6) Promega G1881
GeneRuler 1Kb DNA ladder Thermo Scientific SM0313
SafeView nucleic acid stain NBS Biologicals NBS-SV
DOWNLOAD MATERIALS LIST

References

  1. Chapman, H. D., et al. A selective review of advances in coccidiosis research. Adv Parasitol. 83, 93-171 (2013).
  2. Shirley, M. W., Smith, A. L., Tomley, F. M. The biology of avian Eimeria with an emphasis on their control by vaccination. Adv Parasitol. 60, 285-330 (2005).
  3. Fornace, K. M., et al. Occurrence of Eimeria species parasites on small-scale commercial chicken farms in Africa and indication of economic profitability. PLoS ONE. 8 (12), e84254 (2013).
  4. Schwarz, R. S., Jenkins, M. C., Klopp, S., Miska, K. B. Genomic analysis of Eimeria spp. populations in relation to performance levels of broiler chicken farms in Arkansas and North Carolina. J Parasitol. 95 (4), 871-880 (2009).
  5. Peek, H. W., Landman, W. J. Coccidiosis in poultry: anticoccidial products, vaccines and other prevention strategies. Vet Q. 31 (3), 143-161 (2011).
  6. Johnson, J., Reid, W. M. Anticoccidial drugs: lesion scoring techniques in battery and floor-pen experiments with chickens. Exp Parasitol. 28 (1), 30-36 (1970).
  7. Haug, A., Gjevre, A. G., Skjerve, E., Kaldhusdal, M. A survey of the economic impact of subclinical Eimeria infections in broiler chickens in Norway. Avian Pathol. 37 (3), 333-341 (2008).
  8. Procunier, J., Fernando, M., Barta, J. Species and strain differentiation of Eimeria spp. of the domestic fowl using DNA polymorphisms amplified by arbitrary primers. Parasitology Research. 79 (2), 98-102 (1993).
  9. Schnitzler, B. E., Thebo, P. L., Mattsson, J. G., Tomley, F. M., Shirley, M. W. Development of a diagnostic PCR assay for the detection and discrimination of four pathogenic Eimeria species of the chicken. Avian Pathol. 27 (5), 490-497 (1998).
  10. Vrba, V., Blake, D. P., Poplstein, M. Quantitative real-time PCR assays for detection and quantification of all seven Eimeria species that infect the chicken. Vet Parasitol. 174 (3-4), 183-190 (2010).
  11. Morris, G. M., Gasser, R. B. Biotechnological advances in the diagnosis of avian coccidiosis and the analysis of genetic variation in Eimeria. Biotechnol Adv. 24 (6), 590-603 (2006).
  12. Perry, B., Randolph, T., McDermott, J., Sones, K., Thornton, P. . Investing in animal health research to alleviate poverty. , (2002).
  13. Nagamine, K., Hase, T., Notomi, T. Accelerated reaction by loop-mediated isothermal amplification using loop primers). Mol Cell Probes. 16 (3), 223-229 (2002).
  14. Notomi, T., et al. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 28 (12), E63 (2000).
  15. Kaneko, I., et al. Detection of enterotoxigenic Clostridium perfringens in meat samples by using molecular methods. Appl Environ Microbiol. 77 (21), 7526-7532 (2011).
  16. Karanis, P., et al. Development and preliminary evaluation of a loop-mediated isothermal amplification procedure for sensitive detection of cryptosporidium oocysts in fecal and water samples. Appl Environ Microbiol. 73 (17), 5660-5662 (2007).
  17. Xue, C., et al. Rapid detection of Infectious bursal disease virus by reverse transcription loop-mediated isothermal amplification assay. J Vet Diagn Invest. 21 (6), 841-843 (2009).
  18. Barkway, C. P., Pocock, R. L., Vrba, V., Blake, D. P. Loop-mediated isothermal amplification (LAMP) assays for the species-specific detection of Eimeria that infect chickens. BMC Vet Res. 7 (1), 67 (2011).
  19. Long, P., Joyner, L., Millard, B., Norton, C. A guide to laboratory techniques used in the study and diagnosis of avian coccidiosis. Folia Veterinaria Latina. 6 (3), 201-217 (1976).
  20. Goto, M., Honda, E., Ogura, A., Nomoto, A., Hanaki, K. Colorimetric detection of loop-mediated isothermal amplification reaction by using hydroxy naphthol blue. BioTechniques. 46 (3), 167-172 (2009).
  21. Arakawa, A., Baba, E., Fukata, T. Eimeria tenella infection enhances Salmonella typhimurium infection in chickens. Poult Sci. 60 (10), 2203-2209 (1981).
  22. Blake, D. P., Smith, A. L., Shirley, M. W. Amplified fragment length polymorphism analyses of Eimeria spp.: an improved process for genetic studies of recombinant parasites. Parasitol Res. 90 (6), 473-475 (2003).
  23. Lund, M., Nordentoft, S., Pedersen, K., Madsen, M. Detection of Campylobacter spp. in chicken fecal samples by real-time PCR. J Clin Microbiol. 42 (11), 5125-5132 (2004).
  24. Raj, G. D., et al. Real-time PCR-based quantification of Eimeria genomes: a method to outweigh underestimation of genome numbers due to PCR inhibition. Avian Pathol. 42 (4), 304-308 (2013).
  25. Blake, D. P., Hesketh, P., Archer, A., Shirley, M. W., Smith, A. L. Eimeria maxima: the influence of host genotype on parasite reproduction as revealed by quantitative real-time PCR. Int J Parasitol. 36 (1), 97-105 (2006).
  26. Beck, H. P., et al. Molecular approaches to diversity of populations of apicomplexan parasites. Int J Parasitol. 39 (2), 175-189 (2009).

Tags

EimeriaCoccidiosisLAMP AssaySpecies-specific DetectionChickenGenomic DNAMolecular Diagnosis

Play Video
PDF
DOI
DOWNLOAD MATERIALS LIST
Cite This Article
Barkway, C. P., Pocock, R. L., Vrba, V., Blake, D. P. Loop-mediated Isothermal Amplification (LAMP) Assays for the Species-specific Detection of Eimeria that Infect Chickens. J. Vis. Exp. (96), e52552, doi:10.3791/52552 (2015).
Download Citation
Reprints and Permissions

View Video

✖

To prove you're not a robot, please enter the text in the image below

CAPTCHA Image
Play CAPTCHA Audio
Refresh Image