nasıl kromatin düzenleyiciler ve kromatin devletlerin soru in vivo genom hücre kaderi kararları gelişen embriyonun yapılır ne kadar erken anlayışımıza önemli olduğunu etkileyebilir. ChIP-Seq-küresel düzey bir Xenopus embriyolar için burada özetlenen kromotin özelliklerini araştırmak için en popüler yaklaşım.
The recruitment of chromatin regulators and the assignment of chromatin states to specific genomic loci are pivotal to cell fate decisions and tissue and organ formation during development. Determining the locations and levels of such chromatin features in vivo will provide valuable information about the spatio-temporal regulation of genomic elements, and will support aspirations to mimic embryonic tissue development in vitro. The most commonly used method for genome-wide and high-resolution profiling is chromatin immunoprecipitation followed by next-generation sequencing (ChIP-Seq). This protocol outlines how yolk-rich embryos such as those of the frog Xenopus can be processed for ChIP-Seq experiments, and it offers simple command lines for post-sequencing analysis. Because of the high efficiency with which the protocol extracts nuclei from formaldehyde-fixed tissue, the method allows easy upscaling to obtain enough ChIP material for genome-wide profiling. Our protocol has been used successfully to map various DNA-binding proteins such as transcription factors, signaling mediators, components of the transcription machinery, chromatin modifiers and post-translational histone modifications, and for this to be done at various stages of embryogenesis. Lastly, this protocol should be widely applicable to other model and non-model organisms as more and more genome assemblies become available.
The first attempts to characterize protein-DNA interactions in vivo were reported about 30 years ago in an effort to understand RNA polymerase-mediated gene transcription in bacteria and in the fruit fly1,2. Since then, the use of immunoprecipitation to enrich distinct chromatin features (ChIP) has been widely adopted to capture binding events and chromatin states with high efficiency3. Subsequently, with the emergence of powerful microarray technologies, this method led to the characterization of genome-wide chromatin landscapes4. More recently, chromatin profiling has become even more comprehensive and high-resolution, because millions of co-immunoprecipitated DNA templates can now be sequenced in parallel and mapped to the genome (ChIP-Seq)5. As increasing numbers of genome assemblies are available, ChIP-Seq is an attractive approach to learn more about the genome regulation that underlies biological processes.
Here we provide a protocol to perform ChIP-Seq on yolk-rich embryos such as those of the frog Xenopus. Drafts of the genomes of both widely used Xenopus species—X. tropicalis and X. laevis—have now been released by the International Xenopus Genome Consortium6. The embryos of Xenopus species share many desirable features that facilitate and allow the interpretation of genome-wide chromatin studies, including the production of large numbers of high-quality embryos, the large size of the embryos themselves, and their external development. In addition, the embryos are amenable to classic and novel manipulations like cell lineage tracing, whole-mount in situ hybridisation, RNA overexpression, and TALEN/CRISPR-mediated knockout technology.
The following protocol builds on the work of Lee et al., Blythe et al. and Gentsch et al.7-9. Briefly, Xenopus embryos are formaldehyde-fixed at the developmental stage of interest to covalently bind (cross-link) proteins to their associated genomic DNA. After nuclear extraction, cross-linked chromatin is fragmented to focus subsequent sequencing on specific genomic binding or modification sites, and to minimize the contributions of flanking DNA sequences. Subsequently, the chromatin fragments are immunoprecipitated with a ChIP-grade antibody to enrich those containing the protein of interest. The co-immunoprecipitated DNA is stripped from the protein and purified before creating an indexed (paired-end) library for next-generation sequencing (NGS). At the end, simple command lines are offered for the post-sequencing analysis of ChIP-Seq data.
Bizim protokol yapmak ve Xenopus embriyolar genom kromatin profillerini analiz nasıl özetliyor. Bu silico zenginleştirilmiş genomik siteleri temsil okur milyonlarca işlem, in vivo olarak, endojen mahallere çapraz bağlama proteinlerinden her adımı kapsar. Genom taslaklarının artan sayıda mevcut olduğundan, bu protokol diğer model olan ve olmayan model organizmalar için geçerli olmalıdır. Önceki çalışma 8,31,33,34 dışında bu protokol belirler en önemli deney bölümünde, çapraz-bağlanmış çekirdekleri elde etmek sonrası tespit işlemdir. Verimli kromatin çözünmesini ve kesme ve kolay upscaling kolaylaştırır. Birlikte kütüphane hazırlık geliştirilmiş verimlilik ile bu protokol yarısından itibaren faiz kromatin-ilişkili epitopu ifade iki milyona hücrelerine yüksek karmaşıklık ChIP-Seq kütüphaneler yapıyı sağlar. ChIP-QPCR deneyler için, bu hücrelerin birkaç on bin normal olarak yeterlibelki altı farklı genomik DNA loci zenginleştirme kontrol etmek için. Bu numaralar tahminlerdir, ancak protein ifadesi seviyesi, antikor kalitesine bağlı olarak etkinliği ve epitop ulaşmak çapraz bağlama olarak değişiklik gösterebilir. Bir rehber olarak, tek bir Xenopus embriyo orta Blastula aşama (Nieuwkoop ve Faber 29 den sonra 8.5) yaklaşık 4000 hücreleri içeren geç gastrula aşama (12) de 40,000 hücre ve erken tailbud aşama (20) de 100.000 hücre.
etkin immüno-çökeltme için kesin sabitleme süresi ChIP-qPCR (bölüm 10) tarafından empirik olarak tespit edilmesi gerekmektedir. Deney X içeriyorsa Genel olarak, uzun tespit süreleri gereklidir embriyolar, erken gelişim aşamalarını ve zayıf (ya da dolaylı) DNA bağlama özelliklerini laevis. Bununla birlikte, kromatin kesme daha az etkili hale gelir, 40 dakikadan daha uzun bir Xenopus embriyolar sabitleme ya da belirtilmedikçe, (bölüm 3) daha fazla embriyolar işlem tavsiye edilmez. Bu önemli değildirçok zor sarısı zengin embriyolardan nükleer çıkarma yapabilir formaldehit söndürülmesi için bu ortak adım olarak tespit sonrasında herhangi bir glisin kullanmak için. Şu anda, bunun nedeni bilinmemektedir. Formaldehit-glisin ilave maddesi, ayrıca aşağıdaki amino grupları ya da arginin artığını 35 N-terminali ile reaksiyona düşünülebilir.
Antikor herhangi bir çip deney anahtarıdır ve yeteri kadar kontrol (Landt ve ark. 36 ile kılavuza bakınız) ilgi epitopu için spesifikliğini göstermek amacıyla gerekmektedir. Hiçbir ChIP dereceli antikor varsa bu proteinler işgal endojen bağlayıcı siteleri 37 gibi, epitop füzyon proteinleri karşılık gelen giriş meşru bir alternatif olabilir. Bu durumda, enjeksiyon yapılmamış embriyolar bir negatif kontrol yerine non-spesifik serum ile bir çip olarak kullanmak en iyisidir. İlgi dahilindeki protein Enri zayıf kazanımı ile sonuçlanan, düşük seviyelerde ifade edilir, bu strateji de tatbik edilebilirched DNA.
Çünkü kullanımda DNA düşük miktarda ChIP-Seq kütüphaneler, yapım gelince, bu temizlik adımların sayısını azaltmak ve en azından DNA kaybı tutmak tepkileri birleştirmek işlemleri için tercih edilmesi önerilir. adaptörleri ve primerler (Belirli Malzemeleri / Ekipman Tabloya bakınız) multipleks sıralama ve NGS platformu ile uyumlu olması gerekir. (Uzun tek sarmallı silah içeren) Y-adaptörler kullanarak, bu boyut seçerek DNA ekler önce PCR 3-5 mermi ile ön yükseltmek kütüphane için kritik (örn., 100 bp 300) jel elektroforezi ile. Tek iplikli uçları, DNA fragmanları, heterojen geçirilecek neden olur. Deneme PCR döngüsü sayısını belirlemek için tavsiye edilir giriş DNA (örneğin, 0.1, 0.5, 1, 2, 5, 10 ve 20 ng) farklı miktarlarda (daha az veya 18 döngü eşit) bir boyuta getirmek için gerekli olan 100 ila 200 ng -seçilmiş kütüphanesi. PCR döngü sayısını azaltmak Redu sekanslanmasını vermektedirndant daha az olasıdır okur. Katı faz geri dönüşümlü immobilizasyon boncuklar verimli ilgi DNA kurtarmak ve güvenilir ligasyon ve PCR reaksiyonları herhangi bir serbest adaptörleri ve dimerlerini kaldırmak için reaktifler temizlik iyi.
Sayı, tip ve uzunluk açısından civarında 20-30.000.000 tek uç 36 bp yeterli derinliğe sahip tüm Xenopus genomunu kapsayacak şekilde en ChIP-Seq deneyler için yeterli okur, okur. En yaygın NGS makineleri bu kriterleri karşılama rutin yeteneğine sahiptir. Bununla birlikte, okuma geniş bir dağılımı beklenen ise okur oldukça keskin yükselme daha histon modifikasyonları ile gözlemlendiği üzere, sayısını artırmak için yararlı olabilir. Birçok ChIP-Dizi deneyler için, 4-5 farklı dizin kütüphaneleri birleştirilebiliyor ve yüksek performanslı NGS makinesi kullanılarak bir akış hücresi şeritte dizilenmiştir. Bazen w mappability artırmak için okuma uzunluğu ve diziyi DNA örneğinin iki ucu (paired-end) genişletmek için de tavsiye edilirtekrarlayan genomik bölgelerde kromatin tavuk analiz.
Bu protokol, kopyalama faktörleri, bu sinyal aracı ve post-translasyonel modifikasyonları histon olarak kromatin özelliğin çok çeşitli başarı ile uygulanmıştır. Onlar geliştirmek ve kromatin profilleri yorumlamak zor hale Ancak, embriyolar hücresel heterojenite artan derecesi elde. Ümitli adımlar hücre tipine özgü çekirdek 38,39 ayıklanması doku-spesifik profil kromatin manzara Arabidopsis ve Drosophila yapılmıştır. Bizim protokol, diğer embriyolar doku-spesifik ChIP-Sek için önünü açabilecek bir nükleer çıkarma adımı içerir.
The authors have nothing to disclose.
We thank Chris Benner for implementing the X. tropicalis genome (xenTro2, xenTro2r) into HOMER and the Gilchrist lab for discussions on post-sequencing analysis. I.P. assisted the GO term analysis. G.E.G and J.C.S. were supported by the Wellcome Trust and are now supported by the Medical Research Council (program number U117597140).
1/16 inch tapered microtip | Qsonica | 4417 | This microtip is compatible with Sonicator 3000 from Misonix and Q500/700 from Qsonica. |
8 ml glass sample vial with cap | Wheaton | 224884 | 8 ml clear glass sample vials for aqueous samples with 15-425 size phenolic rubber-lined screw caps. |
Adaptor | IDT or Sigma | NA | TruSeq universal adaptor,
AATGATACGGCGACCACCGAG ATCTACACTCTTTCCCTACAC GACGCTCTTCCGATC*T. TruSeq indexed adaptor, P-GATCGGAAGAGCACACGTC TGAACTCCAGTCAC ‐NNNNNN‐ ATCTCGTATGCCGTCT TCTGCTT*G. *, phosphorothioate bondphosphate group at 5' end. NNNNNN, index (see TruSeq ChIP Sample Preparation Guide for DNA sequence). Order adaptors HPLC purified. Adaptors can be prepared by combining equimolar amounts (each 100 µM) of the universal and the indexed adaptor and cooling them down slowly from 95 °C to room temperature. Use 1.5 pmol per ng of input DNA. Store at -20 °C. |
b2g4pipe (software) | Blast2GO | non-commercial | http://www.blast2go.com/data/blast2go/b2g4pipe_v2.5.zip |
BLAST+ (software) | Camacho et al. | non-commercial | http://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastDocs&DOC_TYPE=Download |
Bowtie (software) | Langmead et al. | non-commercial | http://bowtie-bio.sourceforge.net/index.shtml |
cisFinder (software) | Sharov et al. | non-commercial | http://lgsun.grc.nia.nih.gov/CisFinder/ |
Chip for capillary electrophoresis | Agilent Technologies | 5067-1504 | Load this chip with 1 µl DNA for library quality control. Store at 4 °C. |
Chip-based capillary electrophoresis system | Agilent Technologies | G2940CA | The Agilent 2100 BioAnalyzer is used to check the quality of ChIP-Seq libraries. Keep reagents at 4 °C. |
ChIP-Seq library preparation kit (KAPA Hyper Prep Kit) | Kapa Biosystems | KK8504 | Kit contains KAPA end repair and A-tailing enzyme mix, end Repair and A-tailing buffer, DNA ligase, ligation buffer, KAPA HiFi HotStart ReadyMix (2X), and KAPA library amplification primer mix (10X) (see also PCR primers). Adaptors are not included. Store at -20 °C. |
ChIP-Seq library preparation kit (alternative, ThruPLEX-FD Prep Kit) | Rubicon Genomics | R40048 | Kit uses their own stem-loop adaptors and primers. This kit eliminates intermediate purification steps and is as sensitive as the KAPA Hyper Prep Kit. Store at -20 °C. |
Cluster3 (software) | de Hoon et al. | non-commercial | http://bonsai.hgc.jp/~mdehoon/software/cluster |
FastQC (software) | Simon Andrews | non-commercial | http://www.bioinformatics.babraham.ac.uk/projects/fastqc |
Fluorometer | life technologies | Q32866 | Qubit 2.0 Fluorometer |
Fluorometer reagents | life technologies | Q32851 | The kit provides concentrated assay reagent, dilution buffer, and pre-diluted DNA standards for the Qubit fluorometer. Store DNA standards at 4 °C, buffer and dye at room temperature. |
Formaldehyde | Sigma | F8775-4X25ML | Formaldehyde solution, for molecular biology, 36.5-38% in H2O, stabilised with 10-15% methanol. Store at room temperature. CAUTION: Formaldehyde is corrosive and highly toxic. |
Gel (E-Gel EX agarose , 2%) | life technologies | G4010 | Pre-cast gel with 11 wells, openable format. Leave one lane between ladder and library empty to avoid cross-contamination. Store gels at room temperature. |
Gel electrophoresis system | life technologies | G6465 | E-Gel iBase and E-Gel Safe Imager combo kit for size-selecting ChIP-Seq libraries. |
Gel extraction kit | Qiagen | 28706 | Store all reagents at room temperature. Use 500 µl of QG buffer per 100 mg of 2% agarose gel slice to extract DNA. Use MinElute columns (from MinElute PCR purification kit) to elute DNA twice. |
HOMER (software) | Chris Benner | non-commercial | http://homer.salk.edu/homer/index.html |
Hybridization oven | Techne | FHB1D | Hybridizer HB-1D |
IGV (software) | Robinson et al. | non-commercial | http://www.broadinstitute.org/igv/home |
Illumina CASAVA-1.8 quality filter (software) | Assaf Gordon | non-commercial | http://cancan.cshl.edu/labmembers/gordon/fastq_illumina_filter |
Java TreeView (software) | Alok Saldanha | non-commercial | http://jtreeview.sourceforge.net |
Laboratory jack | Edu-Lab | CH0642 | This jack is used to elevate sample in sound enclosure for sonication. |
Ladder, 100 bp | New England BioLabs | N3231 | Keep 1x solution at room temperature. Store stock at -20 °C. |
Ladder, 1 kb | New England BioLabs | N3232 | Keep 1x solution at room temperature. Store stock at -20 °C. |
Low-retention 1.5-ml microcentrifuge tubes | life technologies | AM12450 | nonstick, RNase-free microfuge tubes, 1.5 ml |
MACS2 (software) | Tao Liu | non-commercial | https://github.com/taoliu/MACS |
Magnetic beads | life technologies | 11201D | These Dynabeads are superparamagnetic beads with affinity purified polyclonal sheep anti-mouse IgG covalently bound to the bead surface. Store at 4 °C. |
Magnetic beads | life technologies | 11203D | These Dynabeads are superparamagnetic beads with affinity purified polyclonal sheep anti-rabbit IgG covalently bound to the bead surface. Store at 4 °C. |
Magnetic beads | life technologies | 10001D | These Dynabeads are superparamagnetic beads with recombinant protein A covalently bound to the bead surface. Store at 4 °C. |
Magnetic beads | life technologies | 10003D | These Dynabeads are superparamagnetic beads with recombinant protein G covalently bound to the bead surface. Store at 4 °C. |
Magnetic rack | life technologies | 12321D | DynaMag-2 magnet |
MEME | Bailey et al. | non-commercial | http://meme.nbcr.net/meme/ |
Na3VO4 | New England BioLabs | P0758 | Sodium orthovanadate (100 mM) is a commonly used general inhibitor for protein phosphotyrosyl phosphatases. Store at -20 °C. |
NaF | New England BioLabs | P0759 | Sodium fluoride (500 mM) is commonly used as general inhibitor of phosphoseryl and phosphothreonyl phosphatases. Store at -20 °C. |
NGS machine | Illumina | SY-301-1301 | Genome Analyzer IIx |
NGS machine (high performance) | Illumina | SY-401-2501 | HiSeq |
Normal serum (antibody control) | Santa Cruz Biotechnology | sc-2028 | Use as control for goat polyclonal IgG antibodies in ChIP-qPCR experiments. Store at 4 °C. |
Normal serum (antibody control) | Santa Cruz Biotechnology | sc-2025 | Use as control for mouse polyclonal IgG antibodies in ChIP-qPCR experiments. Store at 4 °C. |
Normal serum (antibody control) | Santa Cruz Biotechnology | sc-2027 | Use as control for rabbit polyclonal IgG antibodies in ChIP-qPCR experiments. Store at 4 °C. |
Nucleic acid staining solution | iNtRON | 21141 | Use RedSafe nucleic acid staining solution at 1:50,000. Store at room temperature. |
Orange G | Sigma | O3756-25G | 1-Phenylazo-2-naphthol-6,8-disulfonic acid disodium salt. Store at 4 °C. |
PCR primers | e.g., IDT or Sigma | NA | Primers to enrich adaptor-ligated DNA fragments by PCR: AATGATACGGCGACCACCGA*G and CAAGCAGAAGACGGCATACGA*G, phosphorothioate bond. Primers designed by Ethan Ford. Combine primers at 5 µM each. Use 5 µl in a 50 µl PCR reaction. Store at -20 °C. |
MinElute PCR purification kit | Qiagen | 28006 | for purification of ChIP-qPCR and shearing test samples. Store MinElute spin columns at 4 °C, all other buffers and collection tubes at room temperature. |
Phenol:chloroform:isoamyl alcohol (25:24:1, pH 7.9) | life technologies | AM9730 | Phenol:Chloroform:IAA (25:24:1) is premixed and supplied at pH 6.6. Use provided Tris alkaline buffer to raise pH to 7.9. Store at 4 °C. CAUTION: phenol:chloroform:isoamyl alcohol is corrosive, highly toxic and combustible. |
Primer3 (software) | Steve Rozen & Helen Skaletsky | non-commercial | http://biotools.umassmed.edu/bioapps/primer3_www.cgi |
Protease inhibitor tablets | Roche | 11836170001 | cOmplete, Mini, EDTA-free. Use 1 tablet per 10 ml. Store at 4 °C. |
Protease inhibitor tablets | Roche | 11873580001 | cOmplete, EDTA-free. Use 1 tablet per 50 ml. Store at 4 °C. |
Proteinase K | life technologies | AM2548 | proteinase K solution (20 µg/µl). Store at -20 °C. |
RNase A | life technologies | 12091-039 | RNase A (20 µg/µl). Store at room temperature. |
Rotator | Stuart | SB3 | Rotator SB3 |
SAMtools (software) | Li et al. | non-commercial | http://samtools.sourceforge.neta |
Solid phase reversible immobilisation beads | Beckman Coulter | A63882 | The Agencourt AMPure XP beads are used to minimise adaptor dimer contamination in ChIP-Seq libraries. Store at 4 °C. |
Sonicator 3000 | Misonix/Qsonica | NA | Newer models are now available. Q125, Q500 or Q700 are all suitable for shearing crosslinked chromatin. |
Sound enclosure | Misonix/Qsonica | NA | optional: follow the manufacturer's recommendation to obtain the correct sound enclosure. |
Thermomixer | eppendorf | 22670000 | Thermomixer for 24 x 1.5 mL tubes. Precise temperature control from 4 °C above room temperature to 99 °C. |