인간 난포의 유전자 발현 분석
Summary
여기에서는 유전자 발현 분석을 수행하기 위해 냉동 해동된 피질 조직에서 인간 난포를 분리하는 방법을 설명하는 프로토콜을 설명합니다.
Abstract
난소는 서로 다른 세포 유형으로 구성된 이질적인 기관입니다. 모낭 형성 동안 발생하는 분자 메커니즘을 연구하기 위해 고정 조직에서 단백질 및 유전자 발현의 국소화를 수행 할 수 있습니다. 그러나 인간 난포의 유전자 발현 수준을 적절하게 평가하려면 이 복잡하고 섬세한 구조를 분리해야 합니다. 따라서 Woodruff의 실험실에서 이전에 설명한 적응 된 프로토콜은 난포 (난 모세포 및 과립구 세포)를 주변 환경에서 분리하기 위해 개발되었습니다. 난소 피질 조직은 먼저 조직 슬라이서와 조직 다지기의 두 가지 도구를 사용하여 작은 조각을 얻기 위해 수동으로 처리됩니다. 그런 다음 조직은 최소 40분 동안 0.2% 콜라게나제 및 0.02% DNase로 효소적으로 분해됩니다. 이러한 소화 단계는 37°C 및 5%CO2 에서 수행되고, 매 10분마다 배지의 기계적 피펫팅이 수반된다. 배양 후, 분리된 모낭은 현미경 확대 하에서 보정된 미세모세관 피펫을 사용하여 수동으로 수집됩니다. 모낭이 조직 조각에 여전히 존재한다면, 절차는 수동 미세 해부로 완료됩니다. 모낭은 배양 배지의 얼음 위에 수집되고 인산염 완충 식염수 방울로 두 번 헹구어집니다. 이 소화 과정은 난포 악화를 피하기 위해 신중하게 제어되어야 합니다. 난포의 구조가 손상된 것으로 나타나자마자 또는 최대 90분 후, 10% 소 태아 혈청을 함유하는 4°C 블로킹 용액으로 반응을 중지시킨다. 실시간 정량 중합효소 연쇄 반응(RT-qPCR)을 위한 RNA 추출 후 적절한 양의 총 RNA를 얻기 위해 최소 20개의 분리된 모낭(크기 75μm 미만)을 수집해야 합니다. 추출 후 20개의 모낭에서 총 RNA를 정량화하면 평균값 5ng/μL에 도달합니다. 그런 다음 전체 RNA를 cDNA로 역전사하고 RT-qPCR을 사용하여 관심 유전자를 추가로 분석합니다.
Introduction
난소는 피질과 간질 내의 난포를 포함하여 기능적 및 구조적 단위로 구성된 복잡한 기관입니다. 난포 형성(folliculogenesis)은 원시 정지 상태에서 수정이 가능하고 초기 배아 발달을 지원할 수 있는 성숙한 난포로 난포의 활성화, 성장 및 성숙 과정으로, 연구1에서 널리 연구되었다. 이 현상을 유발하는 메커니즘을 밝히면 여성의 불임 관리를 개선할 수 있습니다2. 고정된 인간 조직에 대한 분석을 통해 난소의 기능적 단위 내에서 단백질 발현 및 유전자 국소화를 평가할 수 있습니다 3,4. 그러나 난소 난포 내의 유전자 발현 수준을 정확하게 평가하기 위해 주변 피질에서 난포를 분리하는 특정 기술이 필요합니다. 따라서 이전 연구에서는 난소의 기능 단위에서 직접 유전자 발현을 분석할 수 있는 난포 분리 기술이 개발되었다5. 효소 소화 및/또는 기계적 분리, 레이저 캡처 미세 해부와 같은 다양한 접근법이 개발되어 조직 조각내에서 난포 분리를 허용합니다 6,7,8,9. 난포 분리는 발달의 모든 단계에서 난포의 유전자 발현 프로필을 평가하기 위해 인간 또는 동물의 난소 조직과 함께 널리 사용된다10,11,12. 그러나 최적의 격리 절차는 치밀한 피질 내의 난포의 연약한 구조를 고려해야 하므로 손상을 피하기 위해 주의해서 수행해야 한다7. 이 원고는 유전자 발현 분석을 수행하기 위해 냉동-해동된 난소 피질로부터 인간 모낭을 분리하기 위해 Woodruff의 실험실에서 설명한 프로토콜에서 채택된 절차를 설명합니다13.
냉동 된 인간 조직에서 난소 난포 분리의 첫 번째 단계는 해동 절차입니다. 이 과정은 앞서 기술한 바와 같이, 냉동보존된 난소 조직의 이식에 사용되는 임상 프로토콜에 기초하여 수행된다14,15. 이 과정은 배지의 농도를 낮추면서 난소 피질을 헹구어 동결 방지제를 제거하는 것을 목표로 합니다. 그런 다음 모낭을 회수하기 위해 효소 및 기계적 분리 전에 조직을 단편화합니다. 다른 단계의 모낭은 관심있는 것을 분리하기 위해 고배율과 양질의 광학 장치를 갖춘 실체 현미경을 사용하여 구별 할 수 있습니다. 분리된 각 난포는 현미경에 통합된 자를 사용하여 측정되며, 발달 단계에 따라 모낭을 모을 수 있습니다: 원시 난포(30μm), 1차 난포(60μm), 2차 난포(120-200μm) 및 전방 난포(>200μm)16. 추가 분류는 난포의 형태에 따라 수행 될 수 있습니다 : 원시 난포는 편평한 과립구 세포 (GC)의 한 층을 가지며, 1 차 난포는 1 층의 입방체 GC를 가지며, 2 차 난포는 적어도 2 층의 입방체 GC를 가지며, GC 사이의 공동의 존재는 전방 단계를 특징으로합니다. 관심있는 난포가 선택되면 RNA 추출이 수행됩니다. RNA의 양과 질은 실시간 정량적 중합효소 연쇄 반응(RT-qPCR) 전에 평가됩니다(그림 1).
Protocol
Representative Results
Discussion
난소 조직의 냉동 보존은 암 환자의 생식력을 보존하기 위한 유망한 접근 방식입니다. 클리닉에서 해동 된 피질 조직은 완화 후 환자에게 다시 이식되어 난소 기능과 생식력을 재개 할 수 있습니다19,20. 임상적 사용 외에도, 잔류 난소 단편은 또한 모낭 형성을 조절하는 메커니즘을 연구하기 위해 저장 기간이 끝날 때 연구를 위해 기증될 수 있습니다. ?…
Divulgazioni
The authors have nothing to disclose.
Acknowledgements
이 작업은 EOS(Excellence of Science) 보조금(ID: 30443682)의 지원을 받았습니다. I.D.는 Fonds National de la Recherche Scientifique de Belgique(FNRS)의 부연구원입니다.
Materials
| 2 mm gridded Petri dish | Corning | 430196 | |
| 2100 Bioanalyzer instrument | Agilent | G2939BA | |
| 2100 Expert software | Agilent | version B.02.08.SI648 | |
| 4-wells plate | Sigma Aldrich | D6789 | |
| 6-wells plate | Carl Roth | EKX5.1 | |
| Agilent total RNA 6000 pico kit | Agilent | 5067-1513 | |
| Ascorbic acid | Sigma Aldrich | A4403 | |
| Aspirator tube assemblies for microcapillary pipettes | Sigma Aldrich | A5177 | |
| Centrifuge | Eppendorf | 5424R | |
| Collagenase IV | LifeTechnologies | 17104-019 | |
| DMSO | Sigma Aldrich | D2650 | |
| DNase | Sigma Aldrich | D4527-10kU | |
| FBS | Gibco | 10270-106 | |
| GoScript reverse transcriptase | Promega | A5003 | |
| HSA | CAF DCF | LC4403-41-080 | |
| Leibovitz-15 | LifeTechnologies | 11415-049 | |
| L-Glutamine | Sigma Aldrich | G7513 | |
| McCoy’s 5A + bicarbonate + Hepes | LifeTechnologies | 12330-031 | |
| McIlwain tissue chopper | Stoelting | 51350 | |
| Microcapillary RI EZ-Tips 200 µm | CooperSurgical | 7-72-2200/1 | |
| Microcapillary RI EZ-Tips 75 µm | CooperSurgical | 7-72-2075/1 | |
| NanoDrop 2000/2000c operating software | ThermoFisher | version 1.6 | |
| NanoDrop spectrophotometer | ThermoFisher | 2000/2000c | |
| Penicillin G | Sigma Aldrich | P3032 | |
| PowerTrack SYBR green master mix | ThermoFisher | A46109 | |
| Primers: GDF9 | F: CCAGGTAACAGGAATCCTTC R: GGCTCCTTTATCATTAGATTG | ||
| Primers: HPRT | F: CCTGGCGTCGTGATTAGTGAT R: GAGCACACAGAGGGCTACAA | ||
| Primers: Kit Ligand | F: TGTTACTTTCGTACATTGGCTGG R: AGTCCTGCTCCATGCAAGTT | ||
| Real-Time qPCR Quantstudio 3 | ThermoFisher | A33779 | |
| RNAqueous-micro total RNA isolation kit | ThermoFisher | AM1931 | |
| Selenium | Sigma Aldrich | S9133 | |
| Sodium pyruvate | Sigma Aldrich | S8636 | |
| Stereomicroscope | Nikon | SMZ800 | |
| Streptomycine sulfate | Sigma Aldrich | S1277 | |
| Sucrose | Sigma Aldrich | S1888 | |
| Thermo Scientific Forma Series II water-jacketed CO2 incubators | ThermoFisher | 3110 | |
| Thomas Stadie-Riggs tissue slicer | Thomas Scientific | 6727C10 | |
| Transferrin | Roche | 10652202001 |
Riferimenti
- Gougeon, A. Human ovarian follicular development: From activation of resting follicles to preovulatory maturation. Annales d’Endocrinologie. 71 (3), 132-143 (2010).
- Yang, D. Z., Yang, W., Li, Y., He, Z. Progress in understanding human ovarian folliculogenesis and its implications in assisted reproduction. Journal of Assisted Reproduction and Genetics. 30 (2), 213-219 (2013).
- Rosewell, K. L., Curry, T. E. Detection of ovarian matrix metalloproteinase mRNAs by in situ hybridization. Molecular Endocrinology. 590, 115-129 (2009).
- Tuck, A. R., Robker, R. L., Norman, R. J., Tilley, W. D., Hickey, T. E. Expression and localisation of c-kit and KITL in the adult human ovary. Journal of Ovarian Research. 8, 31 (2015).
- Oktay, K., et al. Isolation and characterization of primordial follicles from fresh and cryopreserved human ovarian tissue. Fertility and Sterility. 67 (3), 481-486 (1997).
- Bonnet, A., et al. Transcriptome profiling of sheep granulosa cells and oocytes during early follicular development obtained by laser capture microdissection. BMC Genomics. 12, 417 (2011).
- Chiti, M. C., et al. A modified and tailored human follicle isolation procedure improves follicle recovery and survival. Journal of Ovarian Research. 10 (1), 71 (2017).
- Kim, E. J., et al. Comparison of follicle isolation methods for mouse ovarian follicle culture in vitro. Reproductive Sciences. 25 (8), 1270-1278 (2018).
- Chen, J., et al. Optimization of follicle isolation for bioengineering of human artificial ovary. Biopreservation and Biobanking. 20 (6), 529-539 (2022).
- Babayev, E., Xu, M., Shea, L. D., Woodruff, T. K., Duncan, F. E. Follicle isolation methods reveal plasticity of granulosa cell steroidogenic capacity during mouse in vitro follicle growth. Molecular Human Reproduction. 28 (10), (2022).
- McDonnell, S. P., Candelaria, J. I., Morton, A. J., Denicol, A. C. Isolation of small preantral follicles from the bovine ovary using a combination of fragmentation, homogenization, and serial filtration. Journal of Visualized Experiments. (187), e64423 (2022).
- Schallmoser, A., Einenkel, R., Färber, C., Sänger, N. In vitro growth (IVG) of human ovarian follicles in frozen thawed ovarian cortex tissue culture supplemented with follicular fluid under hypoxic conditions. Archives of Gynecology and Obstetrics. 306 (4), 1299-1311 (2022).
- Xu, M., et al. In vitro grown human ovarian follicles from cancer patients support oocyte growth. Human Reproduction. 24 (10), 2531-2540 (2009).
- Demeestere, I., Simon, P., Englert, Y., Delbaere, A. Preliminary experience of ovarian tissue cryopreservation procedure: Alternatives, perspectives and feasibility. Reproductive Biomedicine Online. 7 (5), 572-579 (2003).
- Demeestere, I., et al. Ovarian function and spontaneous pregnancy after combined heterotopic and orthotopic cryopreserved ovarian tissue transplantation in a patient previously treated with bone marrow transplantation: Case report. Human Reproduction. 21 (8), 2010-2014 (2006).
- Gougeon, A. Dynamics of follicular growth in the human: A model from preliminary results. Human Reproduction. 1 (2), 81-87 (1986).
- Grosbois, J., Demeestere, I. Dynamics of PI3K and Hippo signaling pathways during in vitro human follicle activation. Human Reproduction. 33 (9), 1705-1714 (2018).
- Grosbois, J., Vermeersch, M., Devos, M., Clarke, H. J., Demeestere, I. Ultrastructure and intercellular contact-mediated communication in cultured human early stage follicles exposed to mTORC1 inhibitor. Molecular Human Reproduction. 25 (11), 706-716 (2019).
- Oktay, K., et al. Endocrine function and oocyte retrieval after autologous transplantation of ovarian cortical strips to the forearm. Journal of the American Medical Association. 286 (12), 1490-1493 (2001).
- Chung, E. H., Lim, S. L., Myers, E., Moss, H. A., Acharya, K. S. Oocyte cryopreservation versus ovarian tissue cryopreservation for adult female oncofertility patients: A cost-effectiveness study. Journal of Assisted Reproduction and Genetics. 38 (9), 2435-2443 (2021).
- Walker, C. A., Bjarkadottir, B. D., Fatum, M., Lane, S., Williams, S. A. Variation in follicle health and development in cultured cryopreserved ovarian cortical tissue: A study of ovarian tissue from patients undergoing fertility preservation. Human Fertility. 24 (3), 188-198 (2021).
- Simon, L. E., Kumar, T. R., Duncan, F. E. In vitro ovarian follicle growth: A comprehensive analysis of key protocol variables. Biology of Reproduction. 103 (3), 455-470 (2020).
- Rice, S., Ojha, K., Mason, H. Human ovarian biopsies as a viable source of pre-antral follicles. Human Reproduction. 23 (3), 600-605 (2008).
- Kristensen, S. G., Rasmussen, A., Byskov, A. G., Andersen, C. Y. Isolation of pre-antral follicles from human ovarian medulla tissue. Human Reproduction. 26 (1), 157-166 (2011).
- Dong, F. -. L., et al. An research on the isolation methods of frozen-thawed human ovarian preantral follicles. International Journal of Clinical and Experimental Medicine. 7 (8), 2298-2303 (2014).
- Lierman, S., et al. Follicles of various maturation stages react differently to enzymatic isolation: a comparison of different isolation protocols. Reproductive Biomedicine Online. 30 (2), 181-190 (2015).
- Abir, R., et al. Pilot study of isolated early human follicles cultured in collagen gels for 24 hours. Human Reproduction. 14 (5), 1299-1301 (1999).
- Abir, R., et al. Morphological study of fully and partially isolated early human follicles. Fertility and Sterility. 75 (1), 141-146 (2001).
- McLaughlin, M., Albertini, D. F., Wallace, W. H. B., Anderson, R. A., Telfer, E. E. Metaphase II oocytes from human unilaminar follicles grown in a multi-step culture system. Molecular Human Reproduction. 24 (3), 135-142 (2018).
- Abir, R., et al. Mechanical isolation and in vitro growth of preantral and small antral human follicles. Fertility and Sterility. 68 (4), 682-688 (1997).
- Vanacker, J., et al. Enzymatic isolation of human primordial and primary ovarian follicles with Liberase DH: Protocol for application in a clinical setting. Fertility and Sterility. 96 (2), 379-383 (2011).
- Amargant, F., et al. Ovarian stiffness increases with age in the mammalian ovary and depends on collagen and hyaluronan matrices. Aging Cell. 19 (11), 13259 (2020).
