ניתוח ביטוי גנים בזקיקים אנושיים
Summary
במאמר זה אנו מתארים פרוטוקול המתאר כיצד לבודד זקיקי שחלות אנושיות מרקמת קליפת המוח שהוקפאה והופשרה כדי לבצע ניתוחי ביטוי גנים.
Abstract
השחלה היא איבר הטרוגני המורכב מסוגי תאים שונים. כדי לחקור את המנגנונים המולקולריים המתרחשים במהלך folliculogenesis, לוקליזציה של חלבונים ביטוי גנים יכול להתבצע על רקמה קבועה. עם זאת, כדי להעריך כראוי את רמות ביטוי הגנים בזקיק אנושי, יש לבודד מבנה מורכב ועדין זה. לפיכך, פותח פרוטוקול מותאם שתואר בעבר על ידי מעבדתו של וודרוף כדי להפריד זקיקים (הביצית ותאי הגרנולוסה) מסביבתם. רקמת קליפת המוח השחלתית מעובדת תחילה באופן ידני כדי להשיג שברים קטנים באמצעות שני כלים: חותך רקמות ומסוק רקמות. לאחר מכן הרקמה מתעכלת אנזימטית עם 0.2% collagenase ו-0.02% DNase למשך 40 דקות לפחות. שלב העיכול הזה מבוצע ב 37 ° C ו 5% CO2 והוא מלווה pipetting מכני של המדיום כל 10 דקות. לאחר הדגירה, הזקיקים המבודדים נאספים ידנית באמצעות פיפטה מיקרוקפילרית מכויילת תחת הגדלה במיקרוסקופ. אם זקיקים עדיין נמצאים בחתיכות הרקמה, ההליך הושלם עם microdissection ידני. הזקיקים נאספים על קרח בתווך תרבית ונשטפים פעמיים בטיפות של תמיסת מלח חוצצת פוספט. הליך עיכול זה חייב להיות מבוקר בקפידה כדי למנוע הידרדרות זקיק. ברגע שנראה שמבנה הזקיקים נפגע או לאחר מקסימום של 90 דקות, התגובה נעצרת עם תמיסת חסימה של 4 מעלות צלזיוס המכילה 10% נסיוב בקר עוברי. יש לאסוף לפחות 20 זקיקים מבודדים (בגודל של פחות מ-75 מיקרומטר) כדי לקבל כמות מספקת של RNA כולל לאחר מיצוי RNA עבור תגובת שרשרת כמותית של פולימראז בזמן אמת (RT-qPCR). לאחר החילוץ, הכימות של סך הרנ”א מ-20 זקיקים מגיע לערך ממוצע של 5 ננוגרם/מיקרוליטר. לאחר מכן הרנ”א הכולל משועתק לאחור ל-cDNA, והגנים המעניינים מנותחים עוד יותר באמצעות RT-qPCR.
Introduction
השחלה היא איבר מורכב המורכב מיחידות תפקודיות ומבניות, כולל הזקיקים בתוך קליפת המוח והסטרומה. פוליקולוגנזה, התהליך של הפעלת זקיקים, גדילה והבשלה ממצב שקט קדמוני לזקיק בוגר המסוגל להיות מופר ולתמוך בהתפתחות עוברית מוקדמת, נחקר רבות במחקר1. חשיפת המנגנונים המניעים תופעה זו עשויה לשפר את טיפולי הפוריות לנשים2. ניתוחים על רקמה אנושית קבועה מאפשרים הערכה של ביטוי חלבונים ולוקליזציה של גנים בתוך היחידות התפקודיות של השחלה 3,4. עם זאת, נדרשות טכניקות ספציפיות כדי לנתק את הזקיקים מקליפת המוח שמסביב כדי להעריך במדויק את רמות ביטוי הגנים בתוך זקיקי השחלות. לפיכך, במחקר קודם פותחה טכניקת בידוד זקיקים המאפשרת ניתוח של ביטוי גנים ישירות מהיחידה התפקודית של השחלה5. גישות שונות פותחו, כגון עיכול אנזימטי ו / או בידוד מכני, כמו גם מיקרודיסקציה לכידת לייזר, המאפשרים בידוד זקיק בתוך פיסת רקמה 6,7,8,9. בידוד זקיקים נמצא בשימוש נרחב, ברקמת שחלה אנושית או חייתית, כדי להעריך את פרופילי ביטוי הגנים של זקיקים בכל שלבי ההתפתחות10,11,12. עם זאת, הליך בידוד אופטימלי צריך לקחת בחשבון את המבנה השביר של הזקיק בתוך קליפת המוח הצפופה, ולכן, צריך להתבצע בזהירות כדי למנוע כל נזק7. כתב יד זה מתאר פרוצדורה, שאומצה מפרוטוקול שתואר על ידי מעבדתו של וודרוף, לבידוד זקיקים אנושיים מקליפת המוח השחלתית שהוקפאה והופשרה לצורך ביצוע ניתוחי ביטוי גנים13.
השלב הראשון של בידוד זקיק השחלות מרקמה אנושית קפואה הוא הליך ההפשרה. תהליך זה מבוצע על בסיס הפרוטוקול הקליני המשמש להשתלת רקמת שחלה קפואה, כפי שתואר קודם לכן14,15. התהליך נועד להסיר את החומרים cryoprotectant על ידי שטיפת קליפת השחלה בריכוז יורד של המדיום. לאחר מכן, הרקמה מקוטעת לפני בידוד אנזימטי ומכני כדי לאחזר את הזקיקים. זקיקים בשלבים שונים ניתן להבחין באמצעות סטריאומיקרוסקופ עם הגדלה גבוהה אופטיקה באיכות טובה על מנת לבודד את אלה המעניינים. כל זקיק מבודד נמדד באמצעות סרגל המשולב במיקרוסקופ, וניתן לאגד את הזקיקים בהתאם לשלב ההתפתחותי שלהם: זקיקים ראשוניים (30 מיקרומטר), זקיקים ראשוניים (60 מיקרומטר), זקיקים שניוניים (120-200 מיקרומטר) וזקיקים אנטראליים (>200 מיקרומטר)16. סיווג נוסף יכול להתבצע על פי המורפולוגיה של הזקיקים: לזקיקים ראשוניים יש שכבה אחת של תאי גרנולוזה שטוחים (GCs), לזקיקים ראשוניים יש שכבה אחת של GCs קובואידיים, לזקיקים משניים יש לפחות שתי שכבות של GCs קובואידיים, ונוכחות חלל בין ה- GCs מאפיינת את השלב האנטראלי. כאשר זקיקים של עניין נבחרים, מיצוי RNA מבוצע. הכמות והאיכות של הרנ”א מוערכות לפני תגובת שרשרת כמותית של פולימראז בזמן אמת (RT-qPCR) (איור 1).
Protocol
Representative Results
Discussion
שימור בהקפאה של רקמת השחלה הוא גישה מבטיחה לשימור פוריותן של חולות סרטן. במרפאה, רקמת קליפת המוח המופשרת מושתלת בחזרה למטופלת לאחר הפוגה, ומאפשרת את חידוש תפקוד השחלות והפוריות19,20. מלבד השימוש הקליני, ניתן לתרום גם שאריות של שברי שחלות למחקר בסוף תקופת האחס?…
Divulgazioni
The authors have nothing to disclose.
Acknowledgements
עבודה זו נתמכה על ידי מענק מצוינות במדע (EOS) (ID: 30443682). I.D. הוא חוקר עמית ב- Fonds National de la Recherche Scientifique de Belgique (FNRS).
Materials
| 2 mm gridded Petri dish | Corning | 430196 | |
| 2100 Bioanalyzer instrument | Agilent | G2939BA | |
| 2100 Expert software | Agilent | version B.02.08.SI648 | |
| 4-wells plate | Sigma Aldrich | D6789 | |
| 6-wells plate | Carl Roth | EKX5.1 | |
| Agilent total RNA 6000 pico kit | Agilent | 5067-1513 | |
| Ascorbic acid | Sigma Aldrich | A4403 | |
| Aspirator tube assemblies for microcapillary pipettes | Sigma Aldrich | A5177 | |
| Centrifuge | Eppendorf | 5424R | |
| Collagenase IV | LifeTechnologies | 17104-019 | |
| DMSO | Sigma Aldrich | D2650 | |
| DNase | Sigma Aldrich | D4527-10kU | |
| FBS | Gibco | 10270-106 | |
| GoScript reverse transcriptase | Promega | A5003 | |
| HSA | CAF DCF | LC4403-41-080 | |
| Leibovitz-15 | LifeTechnologies | 11415-049 | |
| L-Glutamine | Sigma Aldrich | G7513 | |
| McCoy’s 5A + bicarbonate + Hepes | LifeTechnologies | 12330-031 | |
| McIlwain tissue chopper | Stoelting | 51350 | |
| Microcapillary RI EZ-Tips 200 µm | CooperSurgical | 7-72-2200/1 | |
| Microcapillary RI EZ-Tips 75 µm | CooperSurgical | 7-72-2075/1 | |
| NanoDrop 2000/2000c operating software | ThermoFisher | version 1.6 | |
| NanoDrop spectrophotometer | ThermoFisher | 2000/2000c | |
| Penicillin G | Sigma Aldrich | P3032 | |
| PowerTrack SYBR green master mix | ThermoFisher | A46109 | |
| Primers: GDF9 | F: CCAGGTAACAGGAATCCTTC R: GGCTCCTTTATCATTAGATTG | ||
| Primers: HPRT | F: CCTGGCGTCGTGATTAGTGAT R: GAGCACACAGAGGGCTACAA | ||
| Primers: Kit Ligand | F: TGTTACTTTCGTACATTGGCTGG R: AGTCCTGCTCCATGCAAGTT | ||
| Real-Time qPCR Quantstudio 3 | ThermoFisher | A33779 | |
| RNAqueous-micro total RNA isolation kit | ThermoFisher | AM1931 | |
| Selenium | Sigma Aldrich | S9133 | |
| Sodium pyruvate | Sigma Aldrich | S8636 | |
| Stereomicroscope | Nikon | SMZ800 | |
| Streptomycine sulfate | Sigma Aldrich | S1277 | |
| Sucrose | Sigma Aldrich | S1888 | |
| Thermo Scientific Forma Series II water-jacketed CO2 incubators | ThermoFisher | 3110 | |
| Thomas Stadie-Riggs tissue slicer | Thomas Scientific | 6727C10 | |
| Transferrin | Roche | 10652202001 |
Riferimenti
- Gougeon, A. Human ovarian follicular development: From activation of resting follicles to preovulatory maturation. Annales d’Endocrinologie. 71 (3), 132-143 (2010).
- Yang, D. Z., Yang, W., Li, Y., He, Z. Progress in understanding human ovarian folliculogenesis and its implications in assisted reproduction. Journal of Assisted Reproduction and Genetics. 30 (2), 213-219 (2013).
- Rosewell, K. L., Curry, T. E. Detection of ovarian matrix metalloproteinase mRNAs by in situ hybridization. Molecular Endocrinology. 590, 115-129 (2009).
- Tuck, A. R., Robker, R. L., Norman, R. J., Tilley, W. D., Hickey, T. E. Expression and localisation of c-kit and KITL in the adult human ovary. Journal of Ovarian Research. 8, 31 (2015).
- Oktay, K., et al. Isolation and characterization of primordial follicles from fresh and cryopreserved human ovarian tissue. Fertility and Sterility. 67 (3), 481-486 (1997).
- Bonnet, A., et al. Transcriptome profiling of sheep granulosa cells and oocytes during early follicular development obtained by laser capture microdissection. BMC Genomics. 12, 417 (2011).
- Chiti, M. C., et al. A modified and tailored human follicle isolation procedure improves follicle recovery and survival. Journal of Ovarian Research. 10 (1), 71 (2017).
- Kim, E. J., et al. Comparison of follicle isolation methods for mouse ovarian follicle culture in vitro. Reproductive Sciences. 25 (8), 1270-1278 (2018).
- Chen, J., et al. Optimization of follicle isolation for bioengineering of human artificial ovary. Biopreservation and Biobanking. 20 (6), 529-539 (2022).
- Babayev, E., Xu, M., Shea, L. D., Woodruff, T. K., Duncan, F. E. Follicle isolation methods reveal plasticity of granulosa cell steroidogenic capacity during mouse in vitro follicle growth. Molecular Human Reproduction. 28 (10), (2022).
- McDonnell, S. P., Candelaria, J. I., Morton, A. J., Denicol, A. C. Isolation of small preantral follicles from the bovine ovary using a combination of fragmentation, homogenization, and serial filtration. Journal of Visualized Experiments. (187), e64423 (2022).
- Schallmoser, A., Einenkel, R., Färber, C., Sänger, N. In vitro growth (IVG) of human ovarian follicles in frozen thawed ovarian cortex tissue culture supplemented with follicular fluid under hypoxic conditions. Archives of Gynecology and Obstetrics. 306 (4), 1299-1311 (2022).
- Xu, M., et al. In vitro grown human ovarian follicles from cancer patients support oocyte growth. Human Reproduction. 24 (10), 2531-2540 (2009).
- Demeestere, I., Simon, P., Englert, Y., Delbaere, A. Preliminary experience of ovarian tissue cryopreservation procedure: Alternatives, perspectives and feasibility. Reproductive Biomedicine Online. 7 (5), 572-579 (2003).
- Demeestere, I., et al. Ovarian function and spontaneous pregnancy after combined heterotopic and orthotopic cryopreserved ovarian tissue transplantation in a patient previously treated with bone marrow transplantation: Case report. Human Reproduction. 21 (8), 2010-2014 (2006).
- Gougeon, A. Dynamics of follicular growth in the human: A model from preliminary results. Human Reproduction. 1 (2), 81-87 (1986).
- Grosbois, J., Demeestere, I. Dynamics of PI3K and Hippo signaling pathways during in vitro human follicle activation. Human Reproduction. 33 (9), 1705-1714 (2018).
- Grosbois, J., Vermeersch, M., Devos, M., Clarke, H. J., Demeestere, I. Ultrastructure and intercellular contact-mediated communication in cultured human early stage follicles exposed to mTORC1 inhibitor. Molecular Human Reproduction. 25 (11), 706-716 (2019).
- Oktay, K., et al. Endocrine function and oocyte retrieval after autologous transplantation of ovarian cortical strips to the forearm. Journal of the American Medical Association. 286 (12), 1490-1493 (2001).
- Chung, E. H., Lim, S. L., Myers, E., Moss, H. A., Acharya, K. S. Oocyte cryopreservation versus ovarian tissue cryopreservation for adult female oncofertility patients: A cost-effectiveness study. Journal of Assisted Reproduction and Genetics. 38 (9), 2435-2443 (2021).
- Walker, C. A., Bjarkadottir, B. D., Fatum, M., Lane, S., Williams, S. A. Variation in follicle health and development in cultured cryopreserved ovarian cortical tissue: A study of ovarian tissue from patients undergoing fertility preservation. Human Fertility. 24 (3), 188-198 (2021).
- Simon, L. E., Kumar, T. R., Duncan, F. E. In vitro ovarian follicle growth: A comprehensive analysis of key protocol variables. Biology of Reproduction. 103 (3), 455-470 (2020).
- Rice, S., Ojha, K., Mason, H. Human ovarian biopsies as a viable source of pre-antral follicles. Human Reproduction. 23 (3), 600-605 (2008).
- Kristensen, S. G., Rasmussen, A., Byskov, A. G., Andersen, C. Y. Isolation of pre-antral follicles from human ovarian medulla tissue. Human Reproduction. 26 (1), 157-166 (2011).
- Dong, F. -. L., et al. An research on the isolation methods of frozen-thawed human ovarian preantral follicles. International Journal of Clinical and Experimental Medicine. 7 (8), 2298-2303 (2014).
- Lierman, S., et al. Follicles of various maturation stages react differently to enzymatic isolation: a comparison of different isolation protocols. Reproductive Biomedicine Online. 30 (2), 181-190 (2015).
- Abir, R., et al. Pilot study of isolated early human follicles cultured in collagen gels for 24 hours. Human Reproduction. 14 (5), 1299-1301 (1999).
- Abir, R., et al. Morphological study of fully and partially isolated early human follicles. Fertility and Sterility. 75 (1), 141-146 (2001).
- McLaughlin, M., Albertini, D. F., Wallace, W. H. B., Anderson, R. A., Telfer, E. E. Metaphase II oocytes from human unilaminar follicles grown in a multi-step culture system. Molecular Human Reproduction. 24 (3), 135-142 (2018).
- Abir, R., et al. Mechanical isolation and in vitro growth of preantral and small antral human follicles. Fertility and Sterility. 68 (4), 682-688 (1997).
- Vanacker, J., et al. Enzymatic isolation of human primordial and primary ovarian follicles with Liberase DH: Protocol for application in a clinical setting. Fertility and Sterility. 96 (2), 379-383 (2011).
- Amargant, F., et al. Ovarian stiffness increases with age in the mammalian ovary and depends on collagen and hyaluronan matrices. Aging Cell. 19 (11), 13259 (2020).
