차세대 염기서열분석을 위한 뮤린 망막 내피 세포의 분리
Summary
이 프로토콜은 세포 수율, 순도 및 생존성에 최적화된 뮤린 출생후 망막 내피 세포의 단리를 위한 방법을 설명한다. 이 세포는 차세대 시퀀싱 접근법에 적합합니다.
Abstract
차세대 시퀀싱의 최근 개선은 분자 및 세포 생물학에 대한 연구자의 지식을 향상 시켰으며 여러 연구에서 혈관 생물학의 새로운 패러다임을 밝혀 냈습니다. 이러한 방법을 혈관 발달 모델에 적용하려면 배아 및 출생 후 조직에서 세포 분리 기술을 최적화해야합니다. 세포 수율, 생존력 및 순도는 모두 차세대 염기서열분석 접근법에서 정확하고 재현 가능한 결과를 얻기 위해 최대여야 합니다. 신생아 마우스 망막 혈관 형성 모델은 연구자들이 혈관 발달 메커니즘을 연구하는 데 사용됩니다. 연구원들은 이 모델을 사용하여 혈관 형성 및 성숙 동안 혈관신생 및 동맥-정맥 운명 사양의 메커니즘을 조사했습니다. 망막 혈관 개발 모델을 연구하기 위해 차세대 시퀀싱 기술을 적용하려면 세포 수율, 생존력 및 순도를 극대화하는 망막 내피 세포의 분리 방법을 최적화해야 합니다. 이 프로토콜은 형광 활성화 세포 분류 (FACS)를 사용하여 쥐 망막 조직 분리, 소화 및 정제하는 방법을 설명합니다. 상기 결과는 FACS-정제된 CD31+/CD45-내피 세포 집단이 내피 세포 유전자 발현에 대해 고도로 농축되고, FACS 후 60분 동안 생존력의 변화를 나타내지 않음을 나타낸다. 여기에는 벌크 RNA 시퀀싱 및 단일 세포 RNA 시퀀싱을 포함하여 이 방법을 사용하여 분리된 내피 세포에 대한 차세대 시퀀싱 접근법의 대표적인 결과가 포함되어 망막 내피 세포 분리를 위한 이 방법이 차세대 시퀀싱 애플리케이션과 호환됨을 보여줍니다. 이 망막 내피 세포 분리 방법은 혈관 발달의 새로운 메커니즘을 밝히는 고급 시퀀싱 기술을 허용합니다.
Introduction
차세대 염기서열분석 접근법을 통한 핵산 염기서열분석의 높은 처리량은 분자 및 세포 생물학에 대한 연구자들의 지식을 크게 발전시켰습니다. 이러한 고급 기술에는 전체 전사체 RNA 시퀀싱, 단일 염기 다형성(SNP)을 식별하기 위한 표적 영역의 DNA 시퀀싱, 염색질 면역침전(ChIP) 시퀀싱에서 결합된 전사 인자의 DNA 시퀀싱 또는 트랜스포아제 접근 가능 염색질(ATAC) 시퀀싱을 위한 분석에서 열린 염색질 영역 및 단일 세포 RNA 시퀀싱1이 포함됩니다. . 혈관 생물학에서 이러한 발전으로 연구자들은 다양한 표현형 2,3의 연속체를 따라 유전자 발현 패턴을 구별하는 것과 함께 복잡한 발달 및 질병 메커니즘을 밝힐 수있었습니다. 향후 실험에서는 차세대 염기서열분석과 평가된 혈관 발달 모델을 결합하여 복잡한 메커니즘을 추가로 정의할 수 있지만, 시료 전처리 방법은 고급 염기서열분석 기법과 호환되어야 합니다.
차세대 염기서열분석 접근법의 품질, 정확성 및 재현성은 시료 전처리 방법에 따라 달라집니다. 세포의 하위 집합을 분리하거나 조직에서 단일 세포 현탁액을 생성할 때세포 집단의 세포 수, 생존력 및 순도를 최대화하기 위해서는 최적의 분해 및 정제 방법이 필수적입니다4,5. 이것은 소화 방법의 균형을 필요로합니다 : 조직에서 세포를 방출하고 다운 스트림 접근을위한 충분한 세포를 얻으려면 강한 소화가 필요하지만 소화가 너무 강하면 세포 생존율에 부정적인 영향을 미칩니다 6,7. 또한 FACS를 통해 달성할 수 있는 강력한 결과와 정확한 데이터 분석을 위해서는 세포 집단의 순도가 필요합니다. 이는 확립된 혈관 발달 모델에 차세대 염기서열분석을 적용하기 위해 세포 분리 방법을 최적화하는 것의 중요성을 강조합니다.
혈관 발달을 조사하기위한 잘 특성화 된 모델은 쥐 망막 혈관 발달 모델입니다. 뮤린 망막 혈관 구조는 출생 후 2 차원 표면 신경총에서 발생하며, 출생 후 일 (P) 3에 보이는 시신경에서 초기 혈관 신생 싹이 트고, 줄기 및 팁 세포가있는 혈관 신생 전선과 P6에서 볼 수있는 초기 혈관 성숙, P9 8,9 이후에 볼 수있는 혈관 신경총의 성숙. 초기 혈관 신경총의 리모델링 동안, 내피 세포는 순환 네트워크(10,11)를 생성하기 위해 상이한 혈관에서 동맥, 모세 혈관 및 정맥 표현형에 대한 사양을 거친다. 따라서, 이 방법을 통해연구자들은 발달 중 다양한 시점에서 혈관신생 혈관 신경총 형성 및 내피 동맥-정맥 사양 및 성숙을 시각화할 수 있습니다9. 또한, 이 모델은 혈관 발달, 동맥-정맥 기형 및 산소 유도 신생혈관의 조사에 적용된 혈관신생 및 혈관 신경총 발달에 대한 형질전환 조작의 효과를 조사하는 방법을 제공합니다 12,13,14,15,16 . 차세대 염기서열분석 접근법과 쥐 망막 혈관 개발 모델을 결합하려면 망막 조직에서 내피 세포를 분리하기 위한 최적화된 프로토콜이 필요합니다.
이 프로토콜은 P6에서 마우스의 망막 조직을 소화하여 세포 수율, 순도 및 생존력을 극대화하는 최적화된 방법을 설명합니다. 망막 조직을 P6 마우스로부터 분리하고, 20분 동안 소화시키고, CD31 및 CD45에 대해 면역염색하고, FACS를 통해 정제하여 약 2.5시간 내에 내피 세포의 단일 세포 현탁액을 분리한다(도 1A). 이러한 내피 세포는 분리 후 60분 동안 높은 생존력을 유지하는 것으로 밝혀졌으며17, 차세대 시퀀싱 방법을 위한 라이브러리 준비를 가능하게 합니다. 또한 FACS 게이팅 및 품질 관리 결과에 대한 대표 결과가 이 분리 프로토콜을 사용하는 두 가지 개별 차세대 시퀀싱 방법인 전체 전사체 RNA 시퀀싱 및 단일 세포 RNA 시퀀싱에서 제공됩니다. 이 방법을 사용하면 망막 혈관 형성 모델과 함께 차세대 시퀀싱 접근법을 사용하여 혈관 발달의 새로운 메커니즘을 밝힐 수 있습니다.
Protocol
Representative Results
Discussion
이 프로토콜은 높은 세포 수, 순도 및 생존력에 최적화된 출생 후 뮤린 망막 조직으로부터 내피 세포를 분리하는 방법을 설명합니다. 세포 순도는 CD31+/CD45-면역염색에 의해 소화된 단일-세포 현탁액으로부터 내피 세포 집단의 FACS 단리에 의해 수득된다. 분리 품질은 트리판 블루 염색에 의한 생존력 분석 및 CD31, CD45 및 VE-카데린에 대한 qPCR에 의한 유전자 발현에 대한 분석에서 정량화됩니다(VE-카?…
Divulgazioni
The authors have nothing to disclose.
Acknowledgements
Yale Flow Cytometry Facility, University of Virginia Flow Cytometry Core Facility, Yale Center for Genomic Analysis 및 University of Virginia Genome Analysis and Technology Core에 감사드립니다. 이 연구는 NUC (T32 HL007224, T32 HL007284), SC (T32 HL007284), KW (R01 HL142650) 및 K.K.H. (R01 HL146056, R01 DK118728, UH3 EB025765)에 대한 NIH 보조금으로 자금을 지원받았습니다.
Materials
| 2 mL Eppendorf safe-lock tubes | USA Scientific | 4036-3352 | |
| 5 ml Falcon Test Tubes with Cell Strainer Snap Cap | Corning | 352235 | |
| 60 mm Non TC-treated Culture Dish | Corning | 430589 | |
| APC Rat Anti-Mouse CD31 | BD Biosciences | 551262 | |
| APC Rat IgG2a κ Isotype Control | BD Biosciences | 553932 | |
| BD FACSChorus Software | BD Biosciences | FACSCHORUS | |
| BD FACSMelody Cell Sorter | BD Biosciences | FACSMELODY | |
| Collagenase Type II | Sigma-Aldrich | 234115 | |
| Costar 48-well Clear TC-treated Multiple Well Plates, Individually Wrapped, Sterile | Corning | 3548 | |
| D-Glucose | Gibco | A2494001 | |
| Disposable Graduated Transfer Pipettes | Fisher Scientific | 12-711-9AM | |
| Dissecting Pan Wax | Carolina | 629100 | |
| Dissection scissors | Fine Science Tools | 14085-08 | |
| Dissection Stereo Microscope M165 FC | Leica | M165FC | |
| Dulbecco's Modified Eagle Medium (DMEM) | Gibco | 11965-052 | |
| Dulbecco’s Phosphate Buffered Saline (PBS) | Gibco | 14190144 | |
| Eppendorf Flex-Tubes Microcentrifuge Tubes 1.5 mL | Sigma-Aldrich | 22364120 | |
| Fetal Bovine Serum (FBS) | Gemini Bio | 100-106 | |
| Fine dissection forceps | Fine Science Tools | 11250-00 | |
| Hank's Buffered Salt Solution (HBSS) | Gibco | 14175095 | |
| HEPES (1M) | Gibco | 15630130 | |
| iScript cDNA Synthesis Kit | Bio-Rad | 1708890 | |
| Isoflurane, USP | Covetrus | 11695067772 | |
| Isotemp General Purpose Deluxe Water Bath | Fisher Scientific | FSGPD20 | |
| Primer: ActB_Forward: 5’- agagggaaatcgtgcgtgac -3’ | Integrated DNA Technologies | N/A | |
| Primer: ActB_Reverse: 5’- caatagtgatgacctggccgt -3’ | Integrated DNA Technologies | N/A | |
| Primer: CD31_Forward: 5’- gagcccaatcacgtttcagttt -3’ | Integrated DNA Technologies | N/A | |
| Primer: CD31_Reverse: 5’- tccttcctgcttcttgctagct -3’ | Integrated DNA Technologies | N/A | |
| Primer: CD45_Forward: 5’- gggttgttctgtgccttgtt -3’ | Integrated DNA Technologies | N/A | |
| Primer: CD45_Reverse: 5’- ctggacggacacagttagca -3’ | Integrated DNA Technologies | N/A | |
| Primer: VE-Cadherin_Forward: 5’- tcctctgcatcctcactatcaca -3’ | Integrated DNA Technologies | N/A | |
| Primer: VE-Cadherin_Reverse: 5’- gtaagtgaccaactgctcgtgaat -3’ | Integrated DNA Technologies | N/A | |
| Propidium iodide | Sigma-Aldrich | P4864 | |
| RNeasy Plus Mini Kit | Qiagen | 74134 | |
| Sorvall Legend Micro 21R Centrifuge, Refrigerated | ThermoFisher | 75002477 | |
| SYBR-Green iTaq Universal SYBR Green Supermix | Bio-Rad | 172-5120 | |
| Trypan Blue Solution | ThermoFisher | 15250061 | |
| V450 Rat Anti-Mouse CD45 | BD Biosciences | 560501 | |
| V450 Rat IgG2b, κ Isotype Control | BD Biosciences | 560457 |
Riferimenti
- Slatko, B. E., Gardner, A. F., Ausubel, F. M. Overview of next-generation sequencing technologies. Current Protocols in Molecular Biology. 122 (1), 59 (2018).
- Chavkin, N. W., Hirschi, K. K. Single cell analysis in vascular biology. Frontiers in Cardiovascular Medicine. 7, 42 (2020).
- Ma, F., Hernandez, G. E., Romay, M., Iruela-Arispe, M. L. Single-cell RNA sequencing to study vascular diversity and function. Current Opinion in Hematology. 28 (3), 221-229 (2021).
- Potter, A. S., Potter, S. S., S, Dissociation of tissues for single-cell analysis. Methods in Molecular Biology. 1926, 55-62 (2019).
- Braga, F. A. V., Miragaia, R. J. Tissue handling and dissociation for single-cell RNA-seq. Single Cell Methods: Methods in Molecular Biology. 1979, 9-21 (2019).
- Brink, S. C., et al. Single-cell sequencing reveals dissociatin-induced gene expression in tissue subpopulations. Nature Methods. 14 (10), 935-936 (2017).
- Skulska, K., Wegrzyn, A. S., Chelmonska-Soyta, A., Chodaczek, G. Impact of tissue enzymatic digestion on analysis of immune cells in mouse reproductive mucosa with a focus on gammadelta T cells. Journal of Immunological Methods. 474, 112665 (2019).
- Connolly, S., Hores, T., Smith, L., D’Amore, P. Characterization of vascular development in the mouse retina. Microvascular Research. 36 (3), 275-290 (1988).
- Crist, A., Young, C., Meadows, S. Characterization of arteriovenous identity in the developing neonate mouse retina. Gene Expression Patterns: GEP. 23-24, 22-31 (2017).
- dela Paz, N. G., D’Amore, P. A. Arterial versus venous endothelial cells. Cell and Tissue Research. 335 (1), 5-16 (2009).
- Fang, J. S., Hirschi, K. K. Molecular regulation of arteriovenous endothelial cell specification. F1000Res. 8, (2019).
- Smith, L. E., et al. Oxygen-induced retinopathy in the mouse. Investigative Ophthalmology and Visual Science. 35 (1), 101-111 (1994).
- Pitulescu, M. E., Schmidt, I., Benedito, R., Adams, R. H. Inducible gene targeting in the neonatal vasculature and analysis of retinal angiogenesis in mice. Nature Protocols. 5 (9), 1518-1534 (2010).
- Ruiz, S., et al. A mouse model of hereditary hemorrhagic telangiectasia generated by transmammary-delivered immunoblocking of BMP9 and BMP10. Scientific Reports. 6, 37366 (2016).
- Fang, J. S., et al. Shear-induced Notch-Cx37-p27 axis arrests endothelial cell cycle to enable arterial specification. Nature Communication. 8 (1), 2149 (2017).
- Ola, R., et al. SMAD4 prevents flow induced arterial-venous malformations by inhibiting Casein Kinase 2. Circulation. 138 (21), 2379-2394 (2018).
- Chavkin, N. W., Walsh, K., Hirschi, K. K. Isolation of highly purified and viable retinal endothelial cells. Journal of Vascular Research. 58 (1), 49-57 (2020).
- Hulspas, R., O’Gorman, M. R. G., Wood, B. L., Gratama, J. W., Sutherland, D. R. Considerations for the control of background fluorescence in clinical flow cytometry. Cytometry PartB: Clinical Cytometry. 76 (6), 355-364 (2009).
- Bachman, J. Reverse-transcription PCR (RT-PCR). Methods in Enzymology. 530, 67-74 (2013).
- Green, M. R., Sambrook, J. Quantification of RNA by real-time Reverse Transcription-Polymerase Chain Reaction (RT-PCR). Cold Spring Harbour Protocols. 2018 (10), (2018).
- Liu, L., Shi, G. P. CD31: beyond a marker for endothelial cells. Cardiovascular Research. 94 (1), 3-5 (2012).
- Zarkada, G., et al. Specialized endothelial tip cells guide neuroretina vascularization and blood-retina-barrier formation. Developmental Cell. 56 (15), 2237-2251 (2021).
- Su, X., Sorenson, C. M., Sheibani, N. Isolation and characterization of murine retinal endothelial cells. Molecular Vision. 9, 171-178 (2003).
- Benedito, R., et al. The notch ligands Dll4 and Jagged1 have opposing effects on angiogenesis. Cell. 137 (6), 1124-1135 (2009).
- Daneman, R., et al. Wnt/beta-catenin signaling is required for CNS, but not non-CNS, angiogenesis. Proceedings of the National Academy of Sciences of the United States of America. 106 (2), 641-646 (2009).
- Okabe, K., et al. Neurons limit angiogenesis by titrating VEGF in retina. Cell. 159 (3), 584-596 (2014).
- Crist, A. M., Lee, A. R., Patel, N. R., Westhoff, D. E., Meadows, S. M. Vascular deficiency of Smad4 causes arteriovenous malformations: a mouse model of Hereditary Hemorrhagic Telangiectasia. Angiogenesis. 21 (2), 363-380 (2018).
- Kim, Y. H., Choe, S. W., Chae, M. Y., Hong, S., Oh, S. P. SMAD4 deficiency leads to development of arteriovenous malformations in neonatal and adult mice. Journal of the American Heart Association. 7 (21), 009514 (2018).
- Ma, W., et al. Absence of TGFbeta signaling in retinal microglia induces retinal degeneration and exacerbates choroidal neovascularization. eLife. 8, 42049 (2019).
- Luo, W., et al. Arterialization requires the timely suppression of cell growth. Nature. 589 (7842), 437-441 (2021).
- Lawson, N. D., Vogel, A. M., Weinstein, B. M. sonic hedgehog and vascular endothelial growth factor act upstream of the Notch pathway during arterial endothelial differentiation. Developmental Cell. 3 (1), 127-136 (2002).
- Larrivee, B., et al. ALK1 signaling inhibits angiogenesis by cooperating with the Notch pathway. Developmental Cell. 22 (3), 489-500 (2012).
- Wythe, J. D., et al. ETS factors regulate Vegf-dependent arterial specification. Developmental Cell. 26 (1), 45-58 (2013).
- Davis, D. M., Purvis, J. E. Computational analysis of signaling patterns in single cells. Seminars in Cell and Developmental Biology. , 35-43 (2015).
- Gaudet, S., Miller-Jensen, K. Redefining signaling pathways with an expanding single-cell toolbox. Trends in Biotechnology. 34 (6), 458-469 (2016).
- Aibar, S., et al. SCENIC: single-cell regulatory network inference and clustering. Nature Methods. 14 (11), 1083-1086 (2017).
- Trapnell, C., et al. The dynamics and regulators of cell fate decisions are revealed by pseudotemporal ordering of single cells. Nature Biotechnology. 32 (4), 381-386 (2014).
