Summary

Erratum: Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus

Published: March 19, 2019

Abstract

An erratum was issued for: Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus.  There was a typo in Table 1.

In Table 1, the Oligonucleotide sequence for Type III-F5 was updated from:

TTCTCATTGATGCTGAAGCC

To:

GAAACTAGTTATTTCCAACGG

Protocol

An erratum was issued for: Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus.  There was a typo in Table 1. In Table 1, the Oligonucleotide sequence for Type III-F5 was updated from: TTCTCATTGATGCTGAAGCC To: GAAACTAGTTATTTCCAACGG

Divulgazioni

The authors have nothing to disclose.

Citazione di questo articolo
Erratum: Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus. J. Vis. Exp. (145), e6311, doi: (2019).

View Video