JoVE Journal > Immunology and Infection
Summary
Abstract
Introduction
Protocol
Risultati
Discussion
Divulgazioni
Acknowledgements
Materials
Riferimenti
Please note that all translations are automatically generated. Click here for the English version.
Immunologia e infezioni

פרוטוקול נתיישב לייצר חלבונים Site-Specifically Acetylated Escherichia Coli

Published: December 09, 2017
doi:
10.3791/57061
, , , ,
1Department of Chemistry and Biochemistry,University of Arkansas, 2Cell and Molecular Biology Program,University of Arkansas, 3Department of Biological Sciences,University of Arkansas, 4Fayetteville High School

Summary

הרחבת הקוד הגנטי מהווה כלי רב עוצמה כדי ללמוד מגוון רחב של תהליכים ביולוגיים, כולל חלבון acetylation. כאן אנחנו מדגימים פרוטוקול נתיישב לנצל בטכניקה זו ליצירת homogeneously acetylated חלבונים באתרים ספציפיים בתאים Escherichia coli .

Abstract

Post-translational שינויים שמתרחשים עמדות מסוימות של חלבונים הוכחו תפקיד חשוב במגוון רחב של תהליכים תאיים. ביניהם, ליזין הפיך acetylation הוא אחד הנפוצים ביותר מבוזר בכל התחומים של החיים. למרות acetylome מסה ספקטרומטר המבוסס על מחקרים רבים שנעשו, נוספות אפיון של מטרות אלה בשם acetylation הוגבלה. סיבה אפשרית אחת היא כי קשה לייצר חלבונים acetylated גרידא-עמדות הרצוי על-ידי רוב הגישות הביוכימי קלאסי. כדי להתגבר על האתגר הזה, הטכניקה הרחבת הקוד הגנטי הוחל להשתמש הזוג של variant המעביר pyrrolysyl הנדסה-tRNA, שלה tRNA cognate ממינים Methanosarcinaceae , לכוון שיתוף cotranslational של acetyllysine באתר ספציפי בהחלבון של עניין. לאחר היישום הראשון במחקר של acetylation היסטון, גישה זו הנחתה את acetylation מחקרים על מגוון רחב של חלבונים. בעבודה זאת, הפגנו פרוטוקול נתיישב לייצר חלבונים site-specifically acetylated באמצעות החיידק דגם Escherichia coli כמארח. בנויים דהידרוגנאז שימש דוגמה הפגנה בעבודה זו.

Introduction

שינויים post-translational (PTMs) של חלבונים להתרחש לאחר תהליך התרגום, נובעים קוולנטיות תוספת של קבוצות פונקציונליות כדי שאריות חומצה אמינית, משחק תפקידים חשובים כמעט כל התהליכים הביולוגיים, כולל גנים תמלול תגובת המתח, התמיינות, חילוף החומרים1,2,3. נכון להיום, כ 400 ייחודי PTMs היה מזוהה4. הפרטים. של הגנום, את פרוטאום מוגבר במידה רבה על ידי חלבון PTMs, כפי שהם לווסת את פעילות החלבון ולוקליזציה, משפיע על האינטראקציה עם מולקולות אחרות כגון חלבונים, חומצות גרעין, ליפידים, cofactors5.

חלבון acetylation כבר בחוד החנית של מחקרים PTMs האחרון שני עשורים6,7,8,9,10,11,12. ליזין acetylation התגלה לראשונה בשינויים היסטוניים לפני יותר מ 50 שנה13,14, בחן היטב, וידוע להתקיים יותר מ-80 גורמי שעתוק regulators, חלבונים שונים15, 16,17. מחקרים על חלבון acetylation יש לא רק סיפק לנו הבנה עמוקה יותר של מנגנוני רגולציה שלה, אלא מונחה גם טיפולים עבור מספר מחלות שנגרמות על ידי לקוי acetylation18,19, 20 , 21 , 22 , 23. האמינו ליזין acetylation מסרטים פרוקריוטים, אך מחקרים שנעשו לאחרונה הראו acetylation חלבון זה גם ממלא את תפקידי המפתח בפיזיולוגיה חיידקיים, כולל כימוטקסיס, התנגדות חומצה, הפעלה של ייצוב פתוגניות ואיי התקפה אלימה אחרים הקשורים חלבונים24,25,26,27,28,29.

שיטה נפוץ לאפיין מבחינה ביוכימית ליזין acetylation משתמש מוטגנזה. גלוטמין משמש חיקוי של acetyllysine בשל גודל דומה קוטביות. ארגינין הוא מנוצל כמו חיקוי ליזין שאינם acetylated, מאז זה משמר את מטען חיובי בתנאים פיזיולוגיים אבל לא יכול להיות acetylated. עם זאת, שניהם מחקה אינם isosteres האמיתי, לא תמיד יניבו את התוצאות הצפויות30. הגישה קפדני ביותר היא לייצר חלבונים homogeneously acetylated-שאריות ליזין ספציפי, וזה קשה או בלתי אפשרי עבור שיטות הכי קלאסי בשל סטויכיומטריה נמוכה של ליזין acetylation הטבע7,11. האתגר הזה יש כבר נפתר על ידי האסטרטגיה הרחבת הקוד הגנטי, אשר מעסיקה של המעביר pyrrolysyl הנדסה-tRNA variant ממינים Methanosarcinaceae לחייב tRNAPyl עם acetyllysine, מנצל את המארח מכונות translational לדכא את UAG קודון סיום ב- mRNA, ומביאה שילוב של acetyllysine במצב מעוצב של חלבון המטרה31. לאחרונה, אנו יש אופטימיזציה מערכת זו של tRNA EF-Tu-איגוד משופרת32 , של acetyllysyl משודרג-סינתזת המעביר33. יתר על כן, אנו החלת מערכת זו התאגדות משופרת במחקרים acetylation של בנויים דהידרוגנאז34 / tyrosyl-סינתזת המעביר35. במסמך זה, נדגים את הפרוטוקול ליצירת חלבונים acetylated גרידא של שיבוט מולקולרי כדי זיהוי הביוכימי באמצעות בנויים דהידרוגנאז (MDH), אשר אנו חקרו בהרחבה כדוגמה כינוי רמז.

Protocol

1. מוטגנזה של הגן היעד הערה: MDH מבוטא תחת T7 יזם ב וקטור pCDF-1 עם המקור CloDF13 ומספר עותק של 20-4034. להציג את אמבר stop codon במיקום 140 בגן מאת תחל (קדימה פריימר: GGTGTTTATGACתגAACAAACTGTTCGGCG הפוכה פריימר: GGCTTTTTTCAGCACTTCAGCAGCAATTGC), בעקבות ההוראה של ערכת מוטגנזה. להגביר…

Representative Results

התשואה של חלבון MDH acetylated היה 15 מ ג לכל תרבות 1 ליטר, בזמן זה של פראי-סוג MDH היה 31 מ ג 1 ליטר תרבות. חלבונים מטוהרים נותחו על ידי עמודים מרחביות, כפי שמוצג באיור1. MDH פראי-סוג שימש בקרה חיובית34. חלבון מטוהרים מתאי מסתירים את המערכת ההתאגדות acetyllysine (AcK) …

Discussion

שילוב גנטי של חומצות אמינו noncanonical (ncAAs) המבוסס על דיכוי codon שהוקצו, בעיקר אמבר stop codon UAG36,37,38,39, על ידי סינתזת טעון-ncAA המכילה את anticodon המתאים. כידוע, codon UAG מזוהה על-ידי שחרור הפקטור-1 (RF1) של חיידקים, זה ניתן גם לדכא מאת ליד tRNAs cogn…

Divulgazioni

The authors have nothing to disclose.

Acknowledgements

עבודה זו נתמכה על ידי NIH (AI119813), על הסטארט-אפ של אוניברסיטת ארקנסו, ופרס ממוסד החיים ארקנסו.

Materials

Bradford protein assay Bio-Rad 5000006 Protein concentration
4x Laemmli Sample Buffer Bio-Rad 1610747 SDS sample buffer
Coomassie G-250 Stain Bio-Rad 1610786 SDS-PAGE gel staining
4-20% SDS-PAGE ready gel Bio-Rad 4561093 Protein determination
Ac-K-100 (HRP Conjugate) Cell Signaling 6952 Antibody
IPTG CHEM-IMPEX 194 Expression inducer
Nε-Acetyl-L-lysine CHEM-IMPEX 5364 Noncanonical amino acid
PD-10 desalting column GE Healthcare 17085101 Desalting
Q5 Site-Directed Mutagenesis Kit NEB E0554 Introducing the stop codon
BL21 (DE3) cells NEB C2527 Expressing strain
QIAprep Spin Miniprep Kit QIAGEN 27106 Extracting plasmids
Ni-NTA resin QIAGEN 30210 Affinity purification resin
nicotinamide Sigma-Aldrich N3376 Deacetylase inhibitor
β-Mercaptoethanol Sigma-Aldrich M6250 Reducing agent
BugBuster Protein Extraction Reagent Sigma-Aldrich 70584 Breaking cells
Benzonase nuclease Sigma-Aldrich E1014 DNase
ECL Western Blotting Substrate ThermoFisher 32106 Chemiluminescence
Premixed LB Broth VWR 97064 Cell growth medium
Bovine serum albumin VWR 97061-416 western blots blocking
DOWNLOAD MATERIALS LIST

Riferimenti

  1. Krishna, R. G., Wold, F. Post-translational modification of proteins. Adv Enzymol Relat Areas Mol Biol. 67, 265-298 (1993).
  2. Lothrop, A. P., Torres, M. P., Fuchs, S. M. Deciphering post-translational modification codes. FEBS Lett. 587 (8), 1247-1257 (2013).
  3. Walsh, C. T. . Posttranslational modification of proteins : expanding nature’s inventory. , (2006).
  4. Khoury, G. A., Baliban, R. C., Floudas, C. A. Proteome-wide post-translational modification statistics: frequency analysis and curation of the swiss-prot database. Sci Rep. 1, (2011).
  5. Grotenbreg, G., Ploegh, H. Chemical biology: dressed-up proteins. Nature. 446 (7139), 993-995 (2007).
  6. Arif, M., Selvi, B. R., Kundu, T. K. Lysine acetylation: the tale of a modification from transcription regulation to metabolism. Chembiochem. 11 (11), 1501-1504 (2010).
  7. Cohen, T., Yao, T. P. AcK-knowledge reversible acetylation. Science’s STKE : signal transduction knowledge environment. (245), pe42 (2004).
  8. Drazic, A., Myklebust, L. M., Ree, R., Arnesen, T. The world of protein acetylation. Biochim Biophys Acta. 1864 (10), 1372-1401 (2016).
  9. Escalante-Semerena, J. C. Nε-acetylation control conserved in all three life domains. Microbe. 5, 340-344 (2010).
  10. Kouzarides, T. Acetylation: a regulatory modification to rival phosphorylation?. The EMBO journal. 19 (6), 1176-1179 (2000).
  11. Soppa, J. Protein acetylation in archaea, bacteria, and eukaryotes. Archaea. , (2010).
  12. Verdin, E., Ott, M. 50 years of protein acetylation: from gene regulation to epigenetics, metabolism and beyond. Nat Rev Mol Cell Biol. 16 (4), 258-264 (2015).
  13. Allfrey, V. G., Faulkner, R., Mirsky, A. E. Acetylation and Methylation of Histones and Their Possible Role in the Regulation of Rna Synthesis. P Natl Acad Sci USA. 51, 786-794 (1964).
  14. Phillips, D. M. The presence of acetyl groups of histones. Biochem j. 87, 258-263 (1963).
  15. Sterner, D. E., Berger, S. L. Acetylation of histones and transcription-related factors. Microbiology and molecular biology reviews: MMBR. 64 (2), 435-459 (2000).
  16. Glozak, M. A., Sengupta, N., Zhang, X., Seto, E. Acetylation and deacetylation of non-histone proteins. Gene. 363, 15-23 (2005).
  17. Close, P., et al. The emerging role of lysine acetylation of non-nuclear proteins. Cell Mol Life Sci. 67 (8), 1255-1264 (2010).
  18. Iyer, A., Fairlie, D. P., Brown, L. Lysine acetylation in obesity, diabetes and metabolic disease. Immunol Cell Biol. 90 (1), 39-46 (2012).
  19. You, L., Nie, J., Sun, W. J., Zheng, Z. Q., Yang, X. J. Lysine acetylation: enzymes, bromodomains and links to different diseases. Essays Biochem. 52, 1-12 (2012).
  20. Bonnaud, E. M., Suberbielle, E., Malnou, C. E. Histone acetylation in neuronal (dys)function. Biomol Concepts. 7 (2), 103-116 (2016).
  21. Fukushima, A., Lopaschuk, G. D. Acetylation control of cardiac fatty acid beta-oxidation and energy metabolism in obesity, diabetes, and heart failure. Biochim Biophys Acta. 1862 (12), 2211-2220 (2016).
  22. Kaypee, S., et al. Aberrant lysine acetylation in tumorigenesis: Implications in the development of therapeutics. Pharmacol Ther. 162, 98-119 (2016).
  23. Tapias, A., Wang, Z. Q. Lysine Acetylation and Deacetylation in Brain Development and Neuropathies. Genomics Proteomics Bioinformatics. 15 (1), 19-36 (2017).
  24. Hu, L. I., Lima, B. P., Wolfe, A. J. Bacterial protein acetylation: the dawning of a new age. Molecular microbiology. 77 (1), 15-21 (2010).
  25. Jones, J. D., O’Connor, C. D. Protein acetylation in prokaryotes. Proteomics. 11 (15), 3012-3022 (2011).
  26. Bernal, V., et al. Regulation of bacterial physiology by lysine acetylation of proteins. New biotechnol. 31 (6), 586-595 (2014).
  27. Hentchel, K. L., Escalante-Semerena, J. C. Acylation of Biomolecules in Prokaryotes: a Widespread Strategy for the Control of Biological Function and Metabolic Stress. Microbiology and molecular biology reviews : MMBR. 79 (3), 321-346 (2015).
  28. Ouidir, T., Kentache, T., Hardouin, J. Protein lysine acetylation in bacteria: Current state of the art. Proteomics. 16 (2), 301-309 (2016).
  29. Wolfe, A. J. Bacterial protein acetylation: new discoveries unanswered questions. Curr Genet. 62 (2), 335-341 (2016).
  30. Albaugh, B. N., Arnold, K. M., Lee, S., Denu, J. M. Autoacetylation of the histone acetyltransferase Rtt109. J Biol Chem. 286 (28), 24694-24701 (2011).
  31. Neumann, H., Peak-Chew, S. Y., Chin, J. W. Genetically encoding Nε-acetyllysine in recombinant proteins. Nat chem biol. 4 (4), 232-234 (2008).
  32. Fan, C., Xiong, H., Reynolds, N. M., Soll, D. Rationally evolving tRNAPyl for efficient incorporation of noncanonical amino acids. Nucleic Acids Res. 43 (22), e156 (2015).
  33. Bryson, D., et al. Continuous directed evolution of aminoacyl-tRNA synthetases to alter amino acid specificity and enhance activity. Nat Chem Biol. , (2017).
  34. Venkat, S., Gregory, C., Sturges, J., Gan, Q., Fan, C. Studying the Lysine Acetylation of Malate Dehydrogenase. J Mol Biol. 429 (9), 1396-1405 (2017).
  35. Venkat, S., Gregory, C., Gan, Q., Fan, C. Biochemical characterization of the lysine acetylation of tyrosyl-tRNA synthetase in Escherichia coli. Chembiochem. 18 (19), 1928-1934 (2017).
  36. Liu, C. C., Schultz, P. G. Adding new chemistries to the genetic code. Annu Rev Biochem. 79, 413-444 (2010).
  37. Mukai, T., Lajoie, M. J., Englert, M., Soll, D. Rewriting the Genetic Code. Annu Rev Microbiol. , (2017).
  38. O’Donoghue, P., Ling, J., Wang, Y. S., Soll, D. Upgrading protein synthesis for synthetic biology. Nat Chem Biol. 9 (10), 594-598 (2013).
  39. Chin, J. W. Expanding and reprogramming the genetic code of cells and animals. Annu Rev Biochem. 83, 379-408 (2014).
  40. O’Donoghue, P., et al. Near-cognate suppression of amber, opal and quadruplet codons competes with aminoacyl-tRNAPyl for genetic code expansion. FEBS Lett. 586 (21), 3931-3937 (2012).
  41. Aerni, H. R., Shifman, M. A., Rogulina, S., O’Donoghue, P., Rinehart, J. Revealing the amino acid composition of proteins within an expanded genetic code. Nucleic Acids Res. 43 (2), e8 (2015).
  42. Huang, Y., et al. A convenient method for genetic incorporation of multiple noncanonical amino acids into one protein in Escherichia coli. Mol Biosyst. 6 (4), 683-686 (2010).
  43. Venkat, S., et al. Genetically encoding thioacetyl-lysine as a nondeacetylatable analog of lysine acetylation in Escherichia coli. FEBS Open. , (2017).
  44. Wan, W., Tharp, J. M., Liu, W. R. Pyrrolysyl-tRNA synthetase: an ordinary enzyme but an outstanding genetic code expansion tool. Biochim Biophys Acta. 1844 (6), 1059-1070 (2014).
  45. Gregoretti, I. V., Lee, Y. M., Goodson, H. V. Molecular evolution of the histone deacetylase family: functional implications of phylogenetic analysis. J Mol Biol. 338 (1), 17-31 (2004).
  46. Weinert, B. T., et al. Acetyl-phosphate is a critical determinant of lysine acetylation in E. coli. Mol cell. 51 (2), 265-272 (2013).

Tags

Site-specific AcetylationProtein AcetylationGenetic Code ExpansionPyrrolysyl-tRNA SynthetaseAmber Stop CodonE. Coli ExpressionSite-directed MutagenesisAcetyllysine Incorporation

Play Video
PDF
DOI
DOWNLOAD MATERIALS LIST
Citazione di questo articolo
Venkat, S., Gregory, C., Meng, K., Gan, Q., Fan, C. A Facile Protocol to Generate Site-Specifically Acetylated Proteins in Escherichia Coli. J. Vis. Exp. (130), e57061, doi:10.3791/57061 (2017).
Scarica citazione
Ristampe e autorizzazioni

View Video

✖

To prove you're not a robot, please enter the text in the image below

CAPTCHA Image
Play CAPTCHA Audio
Refresh Image