JoVE Journal > Immunology and Infection
Summary
Abstract
Introduction
Protocol
Risultati
Discussion
Divulgazioni
Acknowledgements
Materials
Riferimenti
Please note that all translations are automatically generated. Click here for the English version.
Immunologia e infezioni

Een Facile Protocol voor het genereren van Site-Specifically geacetyleerd eiwitten in Escherichia Coli

Published: December 09, 2017
doi:
10.3791/57061
, , , ,
1Department of Chemistry and Biochemistry,University of Arkansas, 2Cell and Molecular Biology Program,University of Arkansas, 3Department of Biological Sciences,University of Arkansas, 4Fayetteville High School

Summary

Uitbreiding van de genetische code dient als een krachtig hulpmiddel om te bestuderen van een breed scala aan biologische processen, met inbegrip van eiwit acetylation. Hier tonen we een facile protocol misbruiken van deze techniek voor het genereren van homogeen geacetyleerd eiwitten op specifieke sites in Escherichia coli cellen.

Abstract

Posttranslationele modificaties die zich bij specifieke posities van eiwitten voordoen hebben aangetoond dat het spelen een belangrijke rol in een verscheidenheid van cellulaire processen. Onder hen is omkeerbare lysine acetylation één van de meest verspreide in alle domeinen van het leven. Hoewel talrijke massa spectrometrie gebaseerde acetylome studies zijn uitgevoerd, verdere karakterisering van deze vermeende acetylation doelstellingen beperkt gebleven. Een mogelijke reden is dat het moeilijk is te genereren louter geacetyleerd eiwitten op de gewenste positie door de meeste klassieke biochemische benaderingen. Om te overwinnen deze uitdaging, is de genetische code uitbreiding techniek toegepast voor het gebruik van het paar een gemanipuleerde pyrrolysyl-tRNA synthetase variant, en haar cognaat tRNA van Methanosarcinaceae soorten, direct de cotranslational opneming van acetyllysine bij de specifieke site op de proteïne van belang. Na de eerste toepassing in de studie van Histon acetylation, heeft deze aanpak acetylation studies over een verscheidenheid van eiwitten vergemakkelijkt. In dit werk toonden we een facile protocol voor de productie van site-specifically geacetyleerd eiwitten met behulp van het model bacterie Escherichia coli als host. Malate dehydrogenase werd gebruikt als een voorbeeld van de demonstratie in dit werk.

Introduction

Posttranslationele modificaties (PTMs) van eiwitten optreden na het vertaalproces en ontstaan door covalente toevoeging van functionele groepen te aminozuurresidu’s, spelen een belangrijke rol in bijna alle biologische processen, met inbegrip van gene transcriptie, stressrespons, celdifferentiatie en metabolisme1,2,3. Tot op heden heeft ongeveer 400 onderscheidend geweest PTMs geïdentificeerde4. De complexiteit van het genoom en de Proteoom wordt versterkt tot een groot deel door eiwit PTMs, zoals ze reguleren de activiteit van het eiwit en de localisatie en invloed hebben op de interactie met andere moleculen zoals eiwitten, nucleïnezuren, lipiden en cofactoren5.

Eiwit acetylation is in de voorhoede van PTMs studies in de laatste twee decennia6,7,8,9,10,11,12. Lysine acetylation werd het eerst ontdekt in histonen meer dan 50 jaar geleden13,14, heeft al goed onderzocht, en is bekend in meer dan 80 transcriptiefactoren, regelgevers en verschillende eiwitten15, 16,17. Studies over eiwit acetylation hebben niet alleen ons te voorzien van een dieper begrip van de regulerende mechanismen, maar ook begeleide behandelingen voor een aantal ziekten veroorzaakt door disfunctionele acetylation18,19, 20 , 21 , 22 , 23. men geloofde dat lysine acetylation alleen in eukaryoten gebeurt, maar recente studies hebben aangetoond dat eiwitten acetylation speelt ook spelen een belangrijke rol in de bacteriële fysiologie, inclusief chemotaxis, zure weerstand, activering en stabilisatie van pathogeniteit eilanden en andere virulentie gerelateerde eiwitten24,25,26,27,28,29.

Een veelgebruikte methode om biochemically karakteriseren lysine acetylation maakt gebruik van plaats-geleide mutagenese. Glutamine wordt gebruikt als een nabootsen van acetyllysine vanwege zijn vergelijkbare omvang en polariteit. Arginine is gebruikt als een niet-geacetyleerd lysine mimic, aangezien het behoudt haar positieve lading onder fysiologische omstandigheden, maar kan niet worden geacetyleerd. Echter, beide nabootsers zijn geen echte isosteres en doen niet altijd de verwachte resultaten30opbrengst. De meest rigoureuze aanpak is het genereren van homogeen geacetyleerd eiwitten op specifieke lysine residuen, die is moeilijk of onmogelijk voor de meeste klassieke methoden als gevolg van de lage stoichiometrie van lysine acetylation in natuur7,11. Deze uitdaging heeft geweest ontrafeld door de uitbreidingsstrategie van de genetische code, waarin een gemanipuleerde pyrrolysyl-tRNA synthetase werkzaam variant van Methanosarcinaceae soorten in rekening te brengen van tRNAPyl met acetyllysine, maakt gebruik van de host translationeel machines om te onderdrukken de TECOS stop codon in het mRNA en regisseert de opneming van acetyllysine in de ontworpen positie van het doel eiwit31. Onlangs, hebben we dit systeem met een verbeterde EF-Tu-bindende tRNA32 en een bijgewerkte acetyllysyl-tRNA synthetase33geoptimaliseerd. Bovendien hebben we dit systeem van de verbeterde integratie in acetylation studies van malate dehydrogenase34 en tyrosyl-tRNA synthetase35toegepast. Hierin tonen wij het protocol voor het genereren van zuiver geacetyleerd eiwitten van het moleculaire klonen biochemische identificatie met behulp van malate dehydrogenase (MDH), die we hebben uitgebreid bestudeerd als een demonstratieve voorbeeld.

Protocol

1. plaats-geleide mutagenese van het Target-gen Opmerking: MDH is uitgedrukt onder T7 promotor in de vector pCDF-1 met de oorsprong van de CloDF13 en een exemplaaraantal van 20 tot 40-34. Het oranje stop codon op de positie 140 in het gen te introduceren door inleidingen (toekomen primer: GGTGTTTATGACTAGAACAAACTGTTCGGCG en omgekeerde primer: GGCTTTTTTCAGCACTTCAGCAGCAATTGC), volgens de instructies van de plaats-geleide mutagen…

Representative Results

De opbrengst van geacetyleerd MDH eiwit was 15 mg per 1 L cultuur, terwijl dat van wild-type MDH 31 mg per 1 L cultuur was. Gezuiverde eiwitten werden geanalyseerd door SDS-pagina, zoals aangegeven in Figuur 1. De wild-type MDH werd gebruikt als een positieve controle34. Het eiwit gezuiverd uit cellen herbergen van het acetyllysine (AcK) opneming systeem en het mutant mdh -gen, maar zonder AcK in groei media, werd gebruikt als…

Discussion

De genetische opneming van noncanonical aminozuren (ncAAs) is gebaseerd op de onderdrukking van een toegewezen codon, meestal de amber stop codon TECOS36,37,38,39, van het tRNA ncAA-in rekening gebracht die bevatten de overeenkomstige anticodon. Zoals bekend de TECOS codon is erkend door de release factor-1 (RF1) bij bacteriën, en het kan ook worden onderdrukt door in de buurt van cognaat tRNA…

Divulgazioni

The authors have nothing to disclose.

Acknowledgements

Dit werk werd gesteund door de NIH (AI119813), het opstarten van de Universiteit van Arkansas en de award van Arkansas Biosciences Instituut.

Materials

Bradford protein assay Bio-Rad 5000006 Protein concentration
4x Laemmli Sample Buffer Bio-Rad 1610747 SDS sample buffer
Coomassie G-250 Stain Bio-Rad 1610786 SDS-PAGE gel staining
4-20% SDS-PAGE ready gel Bio-Rad 4561093 Protein determination
Ac-K-100 (HRP Conjugate) Cell Signaling 6952 Antibody
IPTG CHEM-IMPEX 194 Expression inducer
Nε-Acetyl-L-lysine CHEM-IMPEX 5364 Noncanonical amino acid
PD-10 desalting column GE Healthcare 17085101 Desalting
Q5 Site-Directed Mutagenesis Kit NEB E0554 Introducing the stop codon
BL21 (DE3) cells NEB C2527 Expressing strain
QIAprep Spin Miniprep Kit QIAGEN 27106 Extracting plasmids
Ni-NTA resin QIAGEN 30210 Affinity purification resin
nicotinamide Sigma-Aldrich N3376 Deacetylase inhibitor
β-Mercaptoethanol Sigma-Aldrich M6250 Reducing agent
BugBuster Protein Extraction Reagent Sigma-Aldrich 70584 Breaking cells
Benzonase nuclease Sigma-Aldrich E1014 DNase
ECL Western Blotting Substrate ThermoFisher 32106 Chemiluminescence
Premixed LB Broth VWR 97064 Cell growth medium
Bovine serum albumin VWR 97061-416 western blots blocking
DOWNLOAD MATERIALS LIST

Riferimenti

  1. Krishna, R. G., Wold, F. Post-translational modification of proteins. Adv Enzymol Relat Areas Mol Biol. 67, 265-298 (1993).
  2. Lothrop, A. P., Torres, M. P., Fuchs, S. M. Deciphering post-translational modification codes. FEBS Lett. 587 (8), 1247-1257 (2013).
  3. Walsh, C. T. . Posttranslational modification of proteins : expanding nature’s inventory. , (2006).
  4. Khoury, G. A., Baliban, R. C., Floudas, C. A. Proteome-wide post-translational modification statistics: frequency analysis and curation of the swiss-prot database. Sci Rep. 1, (2011).
  5. Grotenbreg, G., Ploegh, H. Chemical biology: dressed-up proteins. Nature. 446 (7139), 993-995 (2007).
  6. Arif, M., Selvi, B. R., Kundu, T. K. Lysine acetylation: the tale of a modification from transcription regulation to metabolism. Chembiochem. 11 (11), 1501-1504 (2010).
  7. Cohen, T., Yao, T. P. AcK-knowledge reversible acetylation. Science’s STKE : signal transduction knowledge environment. (245), pe42 (2004).
  8. Drazic, A., Myklebust, L. M., Ree, R., Arnesen, T. The world of protein acetylation. Biochim Biophys Acta. 1864 (10), 1372-1401 (2016).
  9. Escalante-Semerena, J. C. Nε-acetylation control conserved in all three life domains. Microbe. 5, 340-344 (2010).
  10. Kouzarides, T. Acetylation: a regulatory modification to rival phosphorylation?. The EMBO journal. 19 (6), 1176-1179 (2000).
  11. Soppa, J. Protein acetylation in archaea, bacteria, and eukaryotes. Archaea. , (2010).
  12. Verdin, E., Ott, M. 50 years of protein acetylation: from gene regulation to epigenetics, metabolism and beyond. Nat Rev Mol Cell Biol. 16 (4), 258-264 (2015).
  13. Allfrey, V. G., Faulkner, R., Mirsky, A. E. Acetylation and Methylation of Histones and Their Possible Role in the Regulation of Rna Synthesis. P Natl Acad Sci USA. 51, 786-794 (1964).
  14. Phillips, D. M. The presence of acetyl groups of histones. Biochem j. 87, 258-263 (1963).
  15. Sterner, D. E., Berger, S. L. Acetylation of histones and transcription-related factors. Microbiology and molecular biology reviews: MMBR. 64 (2), 435-459 (2000).
  16. Glozak, M. A., Sengupta, N., Zhang, X., Seto, E. Acetylation and deacetylation of non-histone proteins. Gene. 363, 15-23 (2005).
  17. Close, P., et al. The emerging role of lysine acetylation of non-nuclear proteins. Cell Mol Life Sci. 67 (8), 1255-1264 (2010).
  18. Iyer, A., Fairlie, D. P., Brown, L. Lysine acetylation in obesity, diabetes and metabolic disease. Immunol Cell Biol. 90 (1), 39-46 (2012).
  19. You, L., Nie, J., Sun, W. J., Zheng, Z. Q., Yang, X. J. Lysine acetylation: enzymes, bromodomains and links to different diseases. Essays Biochem. 52, 1-12 (2012).
  20. Bonnaud, E. M., Suberbielle, E., Malnou, C. E. Histone acetylation in neuronal (dys)function. Biomol Concepts. 7 (2), 103-116 (2016).
  21. Fukushima, A., Lopaschuk, G. D. Acetylation control of cardiac fatty acid beta-oxidation and energy metabolism in obesity, diabetes, and heart failure. Biochim Biophys Acta. 1862 (12), 2211-2220 (2016).
  22. Kaypee, S., et al. Aberrant lysine acetylation in tumorigenesis: Implications in the development of therapeutics. Pharmacol Ther. 162, 98-119 (2016).
  23. Tapias, A., Wang, Z. Q. Lysine Acetylation and Deacetylation in Brain Development and Neuropathies. Genomics Proteomics Bioinformatics. 15 (1), 19-36 (2017).
  24. Hu, L. I., Lima, B. P., Wolfe, A. J. Bacterial protein acetylation: the dawning of a new age. Molecular microbiology. 77 (1), 15-21 (2010).
  25. Jones, J. D., O’Connor, C. D. Protein acetylation in prokaryotes. Proteomics. 11 (15), 3012-3022 (2011).
  26. Bernal, V., et al. Regulation of bacterial physiology by lysine acetylation of proteins. New biotechnol. 31 (6), 586-595 (2014).
  27. Hentchel, K. L., Escalante-Semerena, J. C. Acylation of Biomolecules in Prokaryotes: a Widespread Strategy for the Control of Biological Function and Metabolic Stress. Microbiology and molecular biology reviews : MMBR. 79 (3), 321-346 (2015).
  28. Ouidir, T., Kentache, T., Hardouin, J. Protein lysine acetylation in bacteria: Current state of the art. Proteomics. 16 (2), 301-309 (2016).
  29. Wolfe, A. J. Bacterial protein acetylation: new discoveries unanswered questions. Curr Genet. 62 (2), 335-341 (2016).
  30. Albaugh, B. N., Arnold, K. M., Lee, S., Denu, J. M. Autoacetylation of the histone acetyltransferase Rtt109. J Biol Chem. 286 (28), 24694-24701 (2011).
  31. Neumann, H., Peak-Chew, S. Y., Chin, J. W. Genetically encoding Nε-acetyllysine in recombinant proteins. Nat chem biol. 4 (4), 232-234 (2008).
  32. Fan, C., Xiong, H., Reynolds, N. M., Soll, D. Rationally evolving tRNAPyl for efficient incorporation of noncanonical amino acids. Nucleic Acids Res. 43 (22), e156 (2015).
  33. Bryson, D., et al. Continuous directed evolution of aminoacyl-tRNA synthetases to alter amino acid specificity and enhance activity. Nat Chem Biol. , (2017).
  34. Venkat, S., Gregory, C., Sturges, J., Gan, Q., Fan, C. Studying the Lysine Acetylation of Malate Dehydrogenase. J Mol Biol. 429 (9), 1396-1405 (2017).
  35. Venkat, S., Gregory, C., Gan, Q., Fan, C. Biochemical characterization of the lysine acetylation of tyrosyl-tRNA synthetase in Escherichia coli. Chembiochem. 18 (19), 1928-1934 (2017).
  36. Liu, C. C., Schultz, P. G. Adding new chemistries to the genetic code. Annu Rev Biochem. 79, 413-444 (2010).
  37. Mukai, T., Lajoie, M. J., Englert, M., Soll, D. Rewriting the Genetic Code. Annu Rev Microbiol. , (2017).
  38. O’Donoghue, P., Ling, J., Wang, Y. S., Soll, D. Upgrading protein synthesis for synthetic biology. Nat Chem Biol. 9 (10), 594-598 (2013).
  39. Chin, J. W. Expanding and reprogramming the genetic code of cells and animals. Annu Rev Biochem. 83, 379-408 (2014).
  40. O’Donoghue, P., et al. Near-cognate suppression of amber, opal and quadruplet codons competes with aminoacyl-tRNAPyl for genetic code expansion. FEBS Lett. 586 (21), 3931-3937 (2012).
  41. Aerni, H. R., Shifman, M. A., Rogulina, S., O’Donoghue, P., Rinehart, J. Revealing the amino acid composition of proteins within an expanded genetic code. Nucleic Acids Res. 43 (2), e8 (2015).
  42. Huang, Y., et al. A convenient method for genetic incorporation of multiple noncanonical amino acids into one protein in Escherichia coli. Mol Biosyst. 6 (4), 683-686 (2010).
  43. Venkat, S., et al. Genetically encoding thioacetyl-lysine as a nondeacetylatable analog of lysine acetylation in Escherichia coli. FEBS Open. , (2017).
  44. Wan, W., Tharp, J. M., Liu, W. R. Pyrrolysyl-tRNA synthetase: an ordinary enzyme but an outstanding genetic code expansion tool. Biochim Biophys Acta. 1844 (6), 1059-1070 (2014).
  45. Gregoretti, I. V., Lee, Y. M., Goodson, H. V. Molecular evolution of the histone deacetylase family: functional implications of phylogenetic analysis. J Mol Biol. 338 (1), 17-31 (2004).
  46. Weinert, B. T., et al. Acetyl-phosphate is a critical determinant of lysine acetylation in E. coli. Mol cell. 51 (2), 265-272 (2013).

Tags

Site-specific AcetylationProtein AcetylationGenetic Code ExpansionPyrrolysyl-tRNA SynthetaseAmber Stop CodonE. Coli ExpressionSite-directed MutagenesisAcetyllysine Incorporation

Play Video
PDF
DOI
DOWNLOAD MATERIALS LIST
Citazione di questo articolo
Venkat, S., Gregory, C., Meng, K., Gan, Q., Fan, C. A Facile Protocol to Generate Site-Specifically Acetylated Proteins in Escherichia Coli. J. Vis. Exp. (130), e57061, doi:10.3791/57061 (2017).
Scarica citazione
Ristampe e autorizzazioni

View Video

✖

To prove you're not a robot, please enter the text in the image below

CAPTCHA Image
Play CAPTCHA Audio
Refresh Image