Onderzoek naar de effecten van probiotica op Pneumococcal Kolonisatie Met behulp van een<em> In Vitro</em> Hechting Assay
Summary
In vitro kan hechting assays worden gebruikt om de hechting van Streptococcus pneumoniae onderzoeken naar cel monolagen epitheliale en mogelijke acties zoals het gebruik van probiotica voor het remmen pneumococcal kolonisatie onderzoeken.
Abstract
Hechting van Streptococcus pneumoniae (pneumokok de) de epitheliale bekleding van de nasofarynx kan resulteren in kolonisatie en wordt beschouwd als een voorwaarde voor pneumococcen infecties zoals longontsteking en otitis media. In vitro hechting assays kunnen worden gebruikt om de hechting van pneumococcen studie naar cel epitheliale monolagen en mogelijke acties, zoals het gebruik van probiotica onderzoeken tegen pneumokokken kolonisatie remmen. De hier beschreven protocol wordt gebruikt om de effecten van de probiotische Streptococcus salivarius de hechting van pneumococcen de humane epitheel cellijn CCL-23 onderzocht (soms aangeduid als HEp-2 cellen). De test bestaat uit drie stappen: 1) de voorbereiding van epitheliale en bacteriële cellen, 2) toevoeging van bacteriën om celmonolagen epitheliale, en 3) de detectie van aanhangend pneumokokken door kiemgetal (seriële verdunning en plating) of kwantitatieve real-time PCR (qPCR ). Deze technique is betrekkelijk eenvoudig en niet gespecialiseerde apparatuur anders dan een weefselkweek setup nodig. De test kan worden gebruikt om andere probiotische soorten en / of potentiële remmers van pneumokokken kolonisatie testen en kan eenvoudig worden aangepast aan andere wetenschappelijke vragen over pneumokokken hechting en invasie te pakken.
Introduction
Streptococcus pneumoniae (pneumokok het) is een Gram-positieve bacterie die infecties zoals longontsteking, middenoorontsteking en hersenvliesontsteking kan veroorzaken. Het is een belangrijke oorzaak van ziekte bij kinderen in landen met lage inkomens en verantwoordelijk voor naar schatting 800.000 sterfgevallen van kinderen onder de leeftijd van vijf jaar 1. Pneumokokken worden vaak gedragen in de nasofarynx van jonge kinderen. Hoewel dit kolonisatie algemeen beschouwd asymptomatisch het vooraf pneumococcen infectie en dient als reservoir voor de bacteriën in menselijke populaties 2. Pneumokokkenvaccinatie vermindert effectief vervoer van de serotypen die in het vaccin. Er zijn meer dan 90 pneumokokkenserotypen en vaccinatie kan leiden tot serotype vervangen, waardoor de eliminatie van vaccinserotypen wordt gevolgd door een stijging in vervoer en ziekte veroorzaakt door nonvaccine serotypen 3. Ook in sommige hoog-risicogroepen, pneumokokkenkolonisatie komt vaak heel vroeg in het leven, vóór de toediening van de eerste dosis vaccin: 4,5. Onlangs is het gebruik van probiotica voorgesteld als aanvullende strategie pneumokokken kolonisatie 6,7 remmen. In vitro hechting assays werden gebruikt om pneumococcen hechting 8,9 onderzocht. Deze testen zijn aangepast om het effect van de probiotische Lactobacillus rhamnosus GG (LGG) op pneumokokken hechting 10 onderzoeken.
Naast LGG en andere melkzuurbacteriën, Streptococcus salivarius, een gemeenschappelijk ingezetene van de mondholte, is onderzocht als een potentiële probiotische de luchtwegen vanwege de kolonisatie potentieel en het vermogen om pneumokokken en andere respiratoire pathogenen in vitro te remmen 11 – 13. De hier gepresenteerde protocol beschrijft een hechting assay gebruikt om de effecten te onderzoeken van S. salivarius K12 op pneumokokken aanhankelijkheidde humane epitheel cellijn CCL-23. Voor gebruik in de assay, werden pneumococcen isolaten onderzocht op hechting mogelijkheden, zoals groei en hechting eigenschappen hoofdzaak onder isolaten 10,14 variëren. Groeicurven van pneumokokken en S. salivarius uitgevoerd om mid-log fase en schatting concentratie (kolonie vormende eenheden of CFU / ml) bepaald door optische dichtheid (OD figuur 1). Het wordt aanbevolen om de groei onderzocht door kiemgetal en OD voor elk isolaat voor gebruik in de assay. Deze test kan worden uitgevoerd in elk laboratorium met standaard weefselkweek faciliteiten en apparatuur. In dit protocol, de effecten van de drie doses van S. salivarius toegediend 1 uur voorafgaande aan de toevoeging van pneumokokken op de hechting van S. pneumoniae PMP843, een serotype 19F wagen isolaat afkomstig van een nasofarynxuitstrijk, worden onderzocht. Twee verschillende manieren om aanhangend pneumokokken kwantificeren worden gepresenteerd: plating op bloed agar om af te schrikkenmijn rendabel telt, en DNA-extractie en detectie van de pneumokokken lytA gen door qPCR 15. De basis hechting assay protocol kan gemakkelijk worden aangepast aan verschillende doses of het tijdstip van toediening van probiotica testen en kunnen ook worden gebruikt met andere bacteriële stammen of soorten.
Protocol
Representative Results
Discussion
Een kritische deel van deze test is het passende concentraties van S. salivarius en pneumokokken in de paragrafen 3.1.7 en 3.1.12. Concentraties worden geschat middels OD maar de exacte inocula zijn niet bepaald tot platen worden geteld de volgende dag. Om deze reden raden wij u aan groeicurven voor OD en levensvatbare tellingen (CFU / ml) na verloop van tijd voor alle bacteriestammen die in de test van de mid-log fase identificeren en te helpen bij de bepaling van de concentratie door de OD te meten. Bovendien…
Divulgazioni
The authors have nothing to disclose.
Acknowledgements
Dit werk werd ondersteund door financiering van de Murdoch Childrens Research Institute en operationele infrastructuur Support Program de Victoriaanse regering.
Materials
| Minimum Essential Media (MEM) | Thermo Fisher Scientific | SH30244.01 | ||
| Fetal Bovine Serum (FBS) | Thermo Fisher Scientific | SH30084.03 | ||
| T-75 Flask | Nunc | 156472 | ||
| CCL-23 cells | ATCC | CCL-23 | ||
| Trypsin | Life Technologies | 15090046 | ||
| 24-well cell culture plate | Nunc | 142475 | ||
| Horse blood agar (HBA) plates | Oxoid | PP2001 | Sheep blood agar plates also acceptable | |
| Todd-Hewitt Broth | Oxoid | CM0189 | ||
| Yeast Extract | Beckton Dickinson | 212750 | ||
| Digitonin | Sigma-Aldrich | D141-100MG | ||
| Disposable cuvettes | Kartell | 1938 | ||
| Heparin | Pfizer | 2112105 | comes in sterile ampules at 5,000IU/5mL | |
| sterile spreader | Technoplas | S10805050 | alternatively, a glass spreader can be dipped in 96% ethanol and flame sterilized before each use | |
| Lysozyme | Sigma-Aldrich | L6876 | ||
| Mutanolysin | Sigma-Aldrich | M9901 | ||
| Proteinase K | Qiagen | 19133 | ||
| SDS 20% solution | Ambion | AM9820 | ||
| RNase A | Qiagen | 19101 | ||
| QIAamp DNA mini-kit (250) | Qiagen | 51306 | ||
| LytA F primer | Sigma-Aldrich | Custom made | 5' -> 3' sequence ACGCAATCTAGCAGATGAAGCA | |
| LytA R primer | Sigma-Aldrich | Custom made | 5' -> 3' sequence TCGTGCGTTTTAATTCCAGCT | |
| LytA probe | Eurogentec | Custom made | 5' -> 3' sequence Cy5-TGCCGAAAACGCTTGATACAGGGAG-BHQ3, alternative fluorophores can be used | |
| Nuclease free water | Ambion | AM9906 | ||
| Brilliant III Ultra Fast QPCR mastermix | Agilent Technologies | 600880 | ||
| Thermo-Fast 96 Detection plate | Thermo Fisher Scientific | AB-1100 | ||
| Ultra clear qPCR cap strips | Thermo Fisher Scientific | AB-0866 | ||
| Mx3005 QPCR System | Agilent Technologies | 401449 | ||
| * alternative sources are available for most/all products listed | ||||
Riferimenti
- O’Brien, K. L., et al. Burden of disease caused by Streptococcus pneumoniae in children younger than 5 years: global estimates. Lancet. 374, 893-902 (2009).
- Bogaert, D., de Groot, R., Hermans, P. W. M. Streptococcus pneumoniae colonisation: the key to pneumococcal disease. Lancet Infect. Dis. 4 (04), 144-154 (2004).
- Weinberger, D. M., Malley, R., Lipsitch, M. Serotype replacement in disease after pneumococcal vaccination. Lancet. 378 (10), 1962-1973 (2011).
- Jacoby, P., et al. Modelling the co-occurrence of Streptococcus pneumoniae with other bacterial and viral pathogens in the upper respiratory tract. Vaccine. 25, 2458-2464 (2007).
- Kwambana, B., Barer, M., Bottomley, C., Adegbola, R., Antonio, M. Early acquisition and high nasopharyngeal co-colonisation by Streptococcus pneumoniae and three respiratory pathogens amongst Gambian new-borns and infants. BMC Infect. Dis. 11, (2011).
- Licciardi, P. V., et al. Protecting against pneumococcal disease: critical interactions between probiotics and the airway microbiome. PLoS Pathog. 8, (2012).
- Popova, M., et al. Beneficial effects of probiotics in upper respiratory tract infections and their mechanical actions to antagonize pathogens. J. Appl. Microbiol. 113 (6), 1305-1318 (2012).
- Pracht, D., et al. PavA of Streptococcus pneumoniae modulates adherence, invasion, and meningeal inflammation. Infect. Immun. 73, 2680-2689 (2005).
- Adamou, J. E., Wizemann, T. M., Barren, P., Langermann, S. Adherence of Streptococcus pneumoniae to human bronchial epithelial cells (BEAS-2B). Infect. Immun. 66, 820-822 (1998).
- Wong, S. S., et al. Inhibition of Streptococcus pneumoniae adherence to human epithelial cells in vitro by the probiotic Lactobacillus rhamnosus GG. BMC Res. Notes. 6 (1), 135 (2013).
- Wescombe, P. A., Heng, N. C. K., Burton, J. P., Chilcott, C. N., Tagg, J. R. Streptococcal bacteriocins and the case for Streptococcus salivarius as model oral probiotics. Future Microbiol. 4, 819-835 (2009).
- Di Pierro, F., Adami, T., Rapacioli, G., Giardini, N., Streitberger, C. Clinical evaluation of the oral probiotic Streptococcus salivarius K12 in the prevention of recurrent pharyngitis and/or tonsillitis caused by Streptococcus pyogenes in adults. Expert. Opin. Biol. Ther. 13 (3), 339-343 (2013).
- Fiedler, T., et al. Protective mechanisms of respiratory tract streptococci against Streptococcus pyogenes biofilm formation and epithelial cell infection. Appl. Environ. Microbiol. 79, 1265-1276 (2013).
- Slotved, H. C., Satzke, C. In vitro growth of pneumococcal isolates representing 23 different serotypes. BMC Res. Notes. 6, 10-1186 (2013).
- Carvalho, M. d. G. S., et al. Evaluation and improvement of real-time PCR assays targeting lytA, ply, and psaA genes for detection of pneumococcal DNA. J. Clin. Microbiol. 45, 2460-2466 (2007).
- Tonnaer, E. L. G. M., et al. Involvement of glycosaminoglycans in the attachment of pneumococci to nasopharyngeal epithelial cells. Microbes Infect. 8, 316-322 (2006).
- Smith-Vaughan, H., et al. Measuring nasal bacterial load and its association with otitis media. BMC Ear Nose Throat Disord. 6, (2006).
- Letourneau, J., Levesque, C., Berthiaume, F., Jacques, M., Mourez, M. In vitro assay of bacterial adhesion onto mammalian epithelial cells. J. Vis. Exp. , (2011).
