Source: Kisserli, A., et al. High-resolution Melting PCR for Complement Receptor 1 Length Polymorphism Genotyping: An Innovative Tool for Alzheimer's Disease Gene Susceptibility Assessment. J. Vis. Exp. (2017).
In this video, we describe a high-resolution melting PCR technique to determine the length polymorphism of DNA fragments of varying sequence lengths, based on melting temperature analysis.
1. HRM-PCR Protocol
Table 1: Primers and parameters used in the high-resolution melting analysis.
2. HRM Analysis to Determine the CR1 Length Polymorphism
NOTE: The methodology described (Figure 1) is specific to our software (See the Table of Materials), although other software packages may be used.
Figure 1: Screenshots of the graphical interface of the software used in step 2 of the protocol. (A) Open the gene scanning software. (B) Amplification program and melting curve program. (C) Click on Sample editor in the Module bar. (D) Select Scanning. (E) Define the properties of the samples. (F) Click on Analysis in the Module bar. (G) Click on the Normalization tab to normalize the melting curves. (H) Click on the Temperature shift tab to show the melting curves that are both normalized and temperature-shifted. (I) Click on the Calculate button to analyze the results and determine the grouping. (J) Click on the Difference plot tab to view the Normalized and Shifted Melting Curves and the Normalized and Temperature Shifted Difference Plot. (K) Colored grouping of the samples according to the CR1 length genotypes.
The authors have nothing to disclose.
Lab coat | protection | ||
SensiCareIce powder-free Nitrile Exam gloves | Medline Industries, Inc, Mundelein, IL 60060, USA | 486802 | sample protection |
Eppendorf Reference 2 pipette, 0.5-10µL | Eppendorf France SAS, F-78360 Montesson, France | 4920000024 | sample pipetting |
Eppendorf Reference 2 pipette, 20-100µL | Eppendorf France SAS, F-78360 Montesson, France | 4920000059 | sample pipetting |
Eppendorf Reference 2 pipette, 100-1000µL | Eppendorf France SAS, F-78360 Montesson, France | 4920000083 | sample pipetting |
TipOne 10µL Graduated, filter tip | Starlab GmbH, D-22926 Ahrenburg, Germany | S1121-3810 | sample pipetting |
TipOne 1-100µL bevelled, filter tip | Starlab GmbH, D-22926 Ahrenburg, Germany | S1120-1840 | sample pipetting |
ART 1000E Barrier Tip | Thermo Fischer Scientific , F-67403 Illkirch, France | 2079E | sample pipetting |
Eppendorf Safe-Lock Tubes, 1.5 mL, Eppendorf Quality | Eppendorf France SAS, F-78360 Montesson, France | 30120086 | mix |
Vortex-Genie 2 | Scientific Industries, Inc, Bohemia, NY 111716, USA | SI-0236 | mix |
Mikro 200 centrifuge | Hettich Zentrifugen, D-78532, Germany | 0002020-02-00 | centrifugation |
Multipette E3 | Eppendorf France SAS, F-78360 Montesson, France | 4987000010 | distribution |
Light Cycler 480 multiwell plate 96, white | Roche Diagnostics GmbH, D-68305 Mannheim, Germany | 4729692001 | reaction place |
Light Cycler 480 sealing foil | Roche Diagnostics GmbH, D-68305 Mannheim, Germany | 4429757001 | coverage |
LightCycler 480 Instrument II, 96-well | Roche Diagnostics GmbH, D-68305 Mannheim, Germany | 05015278001 | high resolution melting polymerase chain reaction |
Heraeus Megafuge 11R centrifuge | Thermo Fischer Scientific , F-67403 Illkirch, France | 75004412 | centrifugation |
LightCycler 480 High Resolution Melting Master | Roche Diagnostics GmbH, D-68305 Mannheim, Germany | 04909631001 | reaction reagents |
CN3 primer: 5'ggccttagacttctcctgc 3' | Eurogentec Biologics Division, B4102 Seraing, Belgium | reaction reagent | |
CN3re primer: 5'gttgacaaattggcggcttcg 3' | Eurogentec Biologics Division, B4102 Seraing, Belgium | reaction reagents | |
light cycler 480 SW 1.5.1 software | Roche Diagnostics GmbH, D-68305 Mannheim, Germany | software used for HRM-PCR CR1 polymorphism data analysis |