Screening for Genomic Modifications: A Method to Identify CRISPR-Generated Mutants in Drosophila
Abstract
Source: Du, L., et al. An Efficient Strategy for Generating Tissue-specific Binary Transcription Systems in Drosophila by Genome Editing. J. Vis. Exp. (2018).
This video describes a screening method to identify transgenic Drosophila flies, whose genome was modified using CRISPR-Cas9. CRISPR-Cas9 is a powerful genome-editing tool that revolutionized the way scientists can manipulate an organism's genome. In the example protocol, we will see how to identify CRISPR-generated mutants, in which an insertion of a transactivation sequence replaces the first exon of the branchless (bnl) gene, thus creating a bnl gene-specific driver line, bnl-LexA.
Protocol
This protocol is an excerpt from Du et al., An Efficient Strategy for Generating Tissue-specific Binary Transcription Systems in Drosophila by Genome Editing, J. Vis. Exp. (2018).
1. Fly genetics and screening (Figure 1 and Figure 2)
- When the injected embryos develop into adults, cross each single G0 flies to balancer flies. Select suitable balancer for the chromosome containing the targeted allele.
- Anesthetize the F1 offspring from each G0 cross on a CO2 pad and randomly pick 10-20 males under a stereomicroscope. Cross them individually to the balancer females as shown in Figure 2.
- When the F2 larvae hatch, pick the single F1 father from each cross and extract gDNA using the single fly genomic DNA preparation protocol:
- Prepare gDNA extraction buffer: 10 mM Tris-Cl pH 8.2, 1 mM EDTA, 25 mM NaCl, store at room temperature. Prepare 20 mg/mL Proteinase K stock solution and store in the freezer.
- Put each fly in a 1.5 mL micro-centrifuge tube and label the tube. Keep in the -80 °C freezer overnight.
- Prepare a fresh working volume of gDNA extraction buffer containing 200 µg/mL final concentration of Proteinase K.
Note: Do not use an old buffer for this step. - Squish each fly for 10–15 s with a pipette tip containing 50 μL of squishing buffer without dispensing the liquid. Dispense the remaining buffer into the tube and mix well. Incubate at 37 °C for 20–30 min.
- Put tubes in 95 °C heat block for 1–2 min to inactivate the Proteinase K.
- Spin down for 5 min at 10,000 x g. Store the preparation at 4 °C for further PCR analysis.
- Use the same method to prepare gDNA from a nos-Cas9 fly, which serves as a negative control. Perform three-step PCR based screens to identify the correct "ends out" HDR (Figure 1, Figure 3) using gDNA of each F1 male as a template5. Use 1 μL of the DNA prep in the following PCR reaction system: 10 μL of 2x PCR Master Mix with Dye, 1 μL of each primer (10 μM), 1 μL of DNA template, and 7 μL of ddH2O.
- As shown in Figure 3A, perform PCR using primers fwd1 and rev1 to screen for the existence of the insertion or replacement; perform PCR using fwd2 and rev2 primers to verify the insertion or replacement from 3' region; perform PCR using primers M13F and rev3 to check "ends-in" HDR (Table 1C).
- Keep the fly lines with the confirmed ends-out HDR and establish balanced stocks from the F2 generation. Outcross to the balancer flies again to remove any unintended mutations on other chromosomes.
Representative Results
Figure 1: An overview of workflow for CRISPR/Cas9-mediated genome editing to generate a binary transcription system. The approximate time duration required for each step is indicated. Please click here to view a larger version of this figure.
Figure 2: An illustration of the CRISPR screening and genetic cross scheme for establishing genome-edited fly lines. In genetic crosses, R stands for the edited allele that is on the 3rd chromosome. MKRS (Tp(3;3)MRS, M(3)76A[1] kar[1] ry[2] Sb[1]), is a 3rd chromosome marker; TM6B (In(3LR)TM6B, Antp[Hu] e[1] Tb[1]) is a 3rd chromosome balancer. Genome edited fly stocks are verified by PCR amplifying the target regions of interest from the genomic DNA extracted from either the F2 or F3 generation flies and sequence determining the PCR products. Please click here to view a larger version of this figure.
Figure 3: Generation of bnl-LexA by CRISPR/Cas9-mediated exon replacement. (A) Schematic drawing depicting the strategy of the CRISPR/Cas9 mediated HDR for exon replacement in the bnl locus. Box – exon; line- intron; replacement donor (pDonor-bnl:LexA) and two possible outcomes of the HDR were shown. The pDonor-bnl:LexA had the following features: (1) T2A-nls-LexA:p65 (~1.8kb) sequence flanked by 2 kb and 1.8 kb long homology arms (dashed lines), (2) a T2A self-cleaving peptide between the residual N terminal bnl exon and the nls-LexA:p65, and (3) a translation stop codon (red *) after the nls-LexA:p65 sequence. The HDR product retained all the transcriptional and post-transcriptional control of bnl, and the LexA:p65 protein is expected to be produced in the same pattern as endogenous Bnl. Small black arrows show the relative binding sites (not in scale) of the PCR primers (Table 1) used for 3-step screening or RT-PCR validation. (B) Agarose gel pictures showing results of the 3-step PCR screening. PCR products amplified from the genomic DNA of four successful ends-out HDR lines are shown; negative control, the genomic DNA of nos-Cas9 parental line; positive control, pDonor-bnl:LexA plasmid; M, Marker (SL2K DNA ladder). (C) An example of the screening gel showing the expected PCR product using primers M13F and rev3 for ends-in lines; M8-7 and M9-6 are two ends-in lines; negative and positive controls, the same as in B; M, Marker (NEB 1 kb DNA ladder). (D) RT-PCR analysis on total RNA from bnl-LexA and the nos-Cas9 control flies. Forward primer binds to a LexA specific region, reverse primer binds to a downstream bnl exon region; ~440 bp (base-pair) amplification band (*) was detected from RT-PCR on bnl-LexAmRNA, but not from the control RNA. M, 100 bp Marker (NEB). Adapted from Figures 2 and S1 in Du et al. 2017. Please click here to view a larger version of this figure.
| A. gRNA cloning and sequencing | |
| bnl-lexA gRNA fwd | TATATAGGAAAGATATCCGGGTGAACTTCgTGTATCTGCGAT |
| GCCCCTCAGTTTTAGAGCTAGAAATAGCAAG | |
| bnl-lexA gRNA rev | ATTTTAACTTGCTATTTCTAGCTCTAAAACTCCCGCAATATCTGAAGG |
| ATcGACGTTAAATTGAAAATAGGTC | |
| T3 primer used for sequencing | CAATTA ACCCTCACTAAAGG-3' |
| NOTE: nucleotides underlined anneal to U6 promoter or gRNA core on pCFD4 vector, the lowercase g/c was added to aid U6 promoter-dependent transcription | |
| B. HDR donor construction | |
| bnl N-F_pUC19 | AATTCGAGCTCGGTACtgtggtctttgaggctggaac |
| bnl-lexA-N-R | tCCGcaagtCagtAGgctgccgcgtccttcgccgga GCCCGCAGATACAAGGCCCC |
| lexA-F | CTactGacttgCGGaGAtGTcGAaGAGAACCCtGGC CCtATGCCACCCAAGAAGAAGC |
| lexA-R | CTAAACGAGTTTTTAAGCAAACTCACTC |
| bnl lexA-C Fwd | TAAAAACTCGTTTAGACGGGATGGCGTTGTCAAC |
| bnl C-R_pUC19 | GCCAAGCTTGCATGCCtcgcataattgccgcctgg |
| NOTE: nucleotides in capital overlap with pUC19 vector for Gibson Assembly, nucleotides underlined were sequence overhang for T2A peptide addition. | |
| C. HDR screening and sequencing | |
| bnl-lexA scr fwd1 | GTGGCGCACGCCCAATAAAC |
| bnl-lexA scr rev1 | GATCCCAGCCAATCTCCGTTG |
| bnl-lexA scr fwd2 | CAACGGAGATTGGCTGGGATC |
| bnl-lexA scr rev2 | CTGGCCAACTGTAGGGAAGTC |
| ends-in check rev3 | GCAATGTTATGCAATGCGTTGAC |
| bnl-lexA seq fwd3 | CACTTGTCGCCCATATTGATACAATTG |
| NOTE: These primers were used for PCR screening and sequencing, the approximate locations of primer binding sites are shown in Figure 5A as fwd1-2 and rev1-3. | |
| D. RT-PCR analysis | |
| RT-f | GATATGGATTTCTCCGCTTTGCTG |
| RT-r | CCATGCAGAGATACAGGCAAGTG |
Table 1: Primers used in this study. (A) Primers for cloning gRNA expression vector and sequencing. (B) Primers for cloning HDR donor template. (C) Primers for screening and sequencing of the HDR products. (D) Primers used for RT-PCR verification of the chimeric LexA-bnl mRNA product.
Materials
| Tris-HCl | Sigma Aldrich | T3253 | Biologia Molecolare |
| EDTA | Sigma Aldrich | E1161 | Biologia Molecolare |
| NaCl | Sigma Aldrich | S7653 | Biologia Molecolare |
| UltraPure DNase/RNase-Free Water | ThermoFisher Scientific | 10977-023 | Biologia Molecolare |
| Primers | IDT-DNA | PCR | |
| Proteinase K | ThermoFisher Scientific | 25530049 | Biologia Molecolare |
| 2x PCR PreMix, with dye (red) | Sydlab | MB067-EQ2R | Biologia Molecolare |
| MKRS/TB6B | Kornberg lab | Fly line | |
| CO2 station | Genesee Scientific | 59-122WCU | fly pushing |
| Stereo microscope | Olympus | SZ-61 | fly pushing |
| Microtube homogenizing pestles | Fisher-Scientific | 03-421-217 | genomic DNA isolation |
