בדיקות אנטי-ויראליות בעלות תפוקה גבוהה למסך עבור מעכבי שכפול וירוס זיקה
Summary
בעבודה זו, אנו מתארים את הפרוטוקולים המשמשים בבדיקות מבוססות אנזים מבוססות replicon ויראלי כדי לסנן מעכבים של שכפול וירוס זיקה בפורמט הקרנה תפוקה גבוהה.
Abstract
גילוי תרופות אנטי ויראליות דורש פיתוח של בדיקות ביוכימיות ותאיות אמינות שניתן לבצע בפורמטים של סינון תפוקה גבוהה (HTS). חלבוני הפלביוירוס הלא מבניים (NS) נחשבים להרכיב באופן תרגום משותף על ממברנות רטיקולום אנדופלסמי (ER), ויוצרים את קומפלקס השכפול (RC). ה- NS3 וה- NS5 הם האנזימים הנחקרים ביותר של ה- RC ומהווים את המטרות העיקריות לפיתוח תרופות בשל תפקידיהם המכריעים בשכפול הגנום הנגיפי. תחום הפרוטאז NS3, הדורש NS2B כגורם המשנה שלו, אחראי על המחשוף של פוליפרוטאין ויראלי לא בוגר לתוך חלבוני NS בוגרים, בעוד NS5 RdRp תחום אחראי על שכפול RNA. להלן, אנו מתארים בפירוט את הפרוטוקולים המשמשים בהקרנות מבוססות replicon ובדיקות אנזימטיות לבדיקת ספריות מורכבות גדולות עבור מעכבי וירוס זיקה (ZIKV) שכפול. replicons הם מערכות תת-גנומיות המשכפלות את עצמם המתבטאות בתאי יונקים, שבהן הגנים המבניים הנגיפיים מוחלפים בגן עיתונאי. ההשפעות המעכבות של תרכובות על שכפול RNA ויראלי ניתן להעריך בקלות על ידי מדידת הירידה בפעילות חלבון הכתב. ההקרנות מבוססות השלילה בוצעו באמצעות קו תא BHK-21 ZIKV המבטא את רנילה לוציפראז כגן עיתונאי. כדי לאפיין את המטרות הספציפיות של תרכובות מזוהות, הקמנו בדיקות מבוססות פלואורסצנטיות במבחנה עבור פרוטאז NS3 ו- NS5 RdRp. הפעילות הפרוטאוליטית של הפרוטאז הנגיפי נמדדה באמצעות מצע הפפטיד הפלואורוגני Bz-nKRR-AMC, בעוד שפעילות התארכות NS5 RdRp זוהתה ישירות על ידי הגידול של האות הפלואורסצנטי של SYBR Green I במהלך התארכות RNA, באמצעות תבנית הפרימטינג העצמית הביוטינילית הסינתטית 3′UTR-U30 (5′-ביוטין-U30-ACUGGAGAUCUCUCCAGU-3′).
Introduction
נגיף זיקה (ZIKV) הוא חבר וירוס מתפתח המועבר בפרוקי רגליים בסוג Flavivirus, הכולל את נגיף דנגי הקשורים קשר הדוק (DENV), וירוס דלקת המוח היפנית (JEV) ווירוס קדחת צהובה (YFV), המהווים איומים מתמידים על בריאות הציבור1. התפרצות ZIKV 2015-16 באמריקה קיבלה תשומת לב עולמית בעקבות הופעתה בברזיל בשל הקשר עם הפרעות נוירולוגיות חמורות, כגון מיקרוצפליה מולדת הקשורה ל- ZIKV בתינוקות2,3 ותסמונת גיליאן-בארה במבוגרים4. למרות שמספר מקרי ההדבקה ירד במהלך השנתיים הבאות, שידורים אוטוכטוניים המועברים על ידי יתושים של ZIKV אומתו ב -87 מדינות וטריטוריות בשנת 2019, ולכן, מה שמפנה את הפוטנציאל של הנגיף להתגלות מחדש כמגיפה5. עד כה, אין חיסונים מאושרים או תרופות יעילות נגד זיהום ZIKV.
גילוי תרופות אנטי-ויראליות דורש פיתוח של בדיקות תאיות וביוכימיות אמינות שניתן לבצע בפורמטים של סינון תפוקה גבוהה (HTS). הקרנות מבוססות Replicon ובדיקות ויראליות מבוססות אנזימים הן שתי אסטרטגיות חשובות לבדיקת תרכובות מולקולה קטנה עבור מעכבי ZIKV1. חלבוני הפלביוירוס הלא מבניים (NS) נחשבים להרכבה תרגומית משותפת על הממברנות הרטיקולום האנדופלזמי (ER), ויוצרים את קומפלקס השכפול (RC)6. ה- NS3 וה- NS5 הם האנזימים הנחקרים ביותר של ה- RC ומהווים את המטרות העיקריות לפיתוח תרופות בשל תפקידיהם המכריעים בשכפול הגנום הנגיפי. תחום פרוטאז NS3, הדורש NS2B כגורם המשנה שלו, אחראי על המחשוף של פוליפרוטאין ויראלי לא בוגר לתוך חלבוני NS בוגרים, ואילו NS5 RdRp תחום אחראי על שכפול RNA6.
replicons הם מערכות תת-גנומיות המשכפלות את עצמם המתבטאות בתאי יונקים, שבהן הגנים המבניים הנגיפיים מוחלפים בגן עיתונאי. ההשפעות המעכבות של תרכובות על שכפול RNA ויראלי ניתן להעריך בקלות על ידי מדידת הירידה בפעילות חלבון הכתב7. להלן, אנו מתארים את הפרוטוקולים המשמשים להקרנת מעכבי שכפול ZIKV בתבנית לוחית 96-well. ההסתה המבוססת על replicon בוצעה באמצעות BHK-21 ZIKV Rluc קו תא כי פיתחנו לאחרונה8. כדי לאפיין את המטרות הספציפיות של תרכובות מזוהות, הקמנו בדיקות מבוססות פלואורסצנטיות במבחנה עבור פרוטאז NS3 המובע באופן רקומביננטי באמצעות מצע הפפטיד הפלואורוגניים, Bz-nKRR-AMC, ואילו עבור NS5 RdRp מדדנו את ההארכה של תבנית הפרימה עצמית ביוטינילית סינתטית 3′UTR-U30 (5′-ביוטין-U30-ACUGGAGAUCUCUCUCCAGU-3′), באמצעות צבע intercalating SYBR Green I.
פרוטאז ZIKV (45-96 שאריות של קופקטור NS2B המקושר לשאריות 1-177 של NS3 תחום פרוטאז על ידי מקשר עשיר גליצין [G4SG4]) הושג, כמתואר עבור YFV9, בעוד פולימראז (276-898 שאריות של תחום RdRp) שוכפל ובא לידי ביטוי, כפי שמפורט ב10. שני רצפי האנזים נגזרו מ- GenBank ALU33341.1. כמו הקרנות אנטי ויראליות ראשוניות, תרכובות נבדקים ב 10 μM ואלה המציגים פעילויות ≥ 80% מוערכים לאחר מכן באופן תלוי מינון, וכתוצאה מכך יעיל / עיכוב (EC50 או IC50) ואת ריכוזים ציטוטוקסית (CC50). בהקשר של תוצאות מייצגות, ערכי EC50 ו CC50 של NITD008, מעכב flaviviruses ידוע11, מן הקרנות מבוססות replicon מוצגים. עבור התקפות אנזימטיות, ערכיIC 50 של שתי תרכובות מתיבת התגובה למגיפה MMV / DNDi, ספרייה המורכבת מ -400 מולקולות עם פעילויות אנטיבקטריאליות, אנטי פטרייתיות ואנטי ויראליות, מוצגים. הפרוטוקולים המתוארים בעבודה זו ניתן לשנות כדי לסנן מעכבים של flaviviruses הקשורים אחרים.
Protocol
Representative Results
Discussion
הפרוטוקולים המתוארים כאן יכולים להיות מותאמים בקלות להקרנות בפורמטים של 384 או 1536-well. עבור הקרנות ביוכימיות ו/או מבוססות תאים המבוצעות בתבנית HTS, ערך פקטור Z’ , פרמטר סטטיסטי, מחושב עבור כל צלחת כדי להבטיח את הרגישות, הרבייה והדיוק של בדיקותאלה 12. ערך פקטור Z של 0.5 ומעלה צפוי להקרנו…
Divulgations
The authors have nothing to disclose.
Acknowledgements
עבודה זו נתמכה על ידי Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP), CEPID grant 2013/07600-3 to GO, grant 2018/05130-3 ל- RSF ו- 2016/19712-9 ל- ASG, ו- Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (grant 88887.516153/2020-00) ל- ASG. ברצוננו להודות בהכרת תודה לרפואה על מלריה ונצ’רס (MMV, www.mmv.org) וליוזמת התרופות למחלות מוזנחות (DNDi, www.dndi.org) על תמיכתם, עיצוב תיבת התגובה למגיפה ואספקת התרכובות.
Materials
| 5'-biotin-U30- ACUGGAGAUCGAUCUCCAGU -3' | Dharmacon | – | 100 ng |
| 96-well cell culture plates | KASVI | K12-096 | |
| 96-well PCR Microplate | KASVI | K4-9610 | |
| 96-well White Flat Bottom Polystyrene High Bind Microplate | Corning | 3922 | |
| AMC (7-amine-4-methylcoumarine) | SIGMA-Aldrich | 257370 | 100 mg |
| Aprotinin from bovine lung | SIGMA-Aldrich | A1153 | 10 mg |
| ATP | JenaBioscience | NU-1010-1G | 1 g |
| Bz-nKRR-AMC | International Peptides | – | 5 mg |
| Class II Biohazard Safety Cabinet | ESCO | ||
| Diethyl pyrocarbonate | SIGMA-Aldrich | D5758 | 25 mL |
| DMSO (Dimethyl sulfoxide) | SIGMA-Aldrich | 472301 | 1 L |
| Dulbecco’s Modified Eagle Medium | GIBCO | 3760091 | |
| Fetal Bovine Serum | GIBCO | 12657-029 | 500 mL |
| G418 | SIGMA-Aldrich | A1720 | Disulfate salt |
| Glycerol | SIGMA-Aldrich | G5516 | 1 L |
| HERACELL VIOS 160i CO2 incubator | Thermo Scientific | ||
| MnCl2 tetrahydrate | SIGMA-Aldrich | 203734 | 25 g |
| MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide) | Invitrogen | M6494 | |
| NITD008 ≥98% (HPLC) | Sigma-Aldrich | SML2409 | 5 mg |
| qPCR system Mx3000P | Agilent | ||
| Renilla luciferase Assay System | PROMEGA | E2810 | |
| SpectraMax Gemini EM Fluorescence Reader | Molecular Devices | ||
| SpectraMax i3 Multi-Mode Detection Platform | Molecular Devices | ||
| SpectraMax Plus 384 Absorbance Microplate Reader | Molecular Devices | ||
| SYBR Green I | Invitrogen | S7563 | 500 µl |
| Triton X-100 | SIGMA-Aldrich | X100 | 500 mL |
| Trizma base | SIGMA-Aldrich | T1503 | 1 kg |
| Trypsin-EDTA Solution 1X | SIGMA-Aldrich | 59417-C | 100 mL |
References
- Zou, J., Shi, P. Y. Strategies for Zika drug discovery. Current Opinion in Virology. 35, 19-26 (2019).
- Cugola, F. R., et al. The Brazilian Zika virus strain causes birth defects in experimental models. Nature. 534 (7606), 267-271 (2016).
- de Araújo, T. V. B., et al. Association between microcephaly, Zika virus infection, and other risk factors in Brazil: Final report of a case-control study. The Lancet Infectious Diseases. 18 (3), 328-336 (2018).
- Cao-Lormeau, V. -. M., et al. Guillain-Barré Syndrome outbreak associated with Zika virus infection in French Polynesia: a case-control study. The Lancet. 387 (10027), 1531-1539 (2016).
- Pielnaa, P., et al. Zika virus-spread, epidemiology, genome, transmission cycle, clinical manifestation, associated challenges, vaccine and antiviral drug development. Virology. 543, 34-42 (2020).
- Bollati, M., et al. Structure and functionality in flavivirus NS-proteins: Perspectives for drug design Flaviviral NS3 protein Flaviviral NS5 protein Protease Helicase Polymerase Methyltransferase Flavivirus protein structure Antivirals VIZIER Consortium. Antiviral Research. 87, 125-148 (2010).
- Fernandes, R. S., et al. Reporter replicons for antiviral drug discovery against positive single-stranded RNA viruses. Viruses. 12 (6), (2020).
- Fernandes, R. S., et al. Discovery of an imidazonaphthyridine and a riminophenazine as potent anti-Zika virus agents through a replicon-based high-throughput screening. Virus Research. 299, 198388 (2021).
- Noske, G. D., et al. Structural characterization and polymorphism analysis of the NS2B-NS3 protease from the 2017 Brazilian circulating strain of Yellow Fever virus. Biochimica et Biophysica Acta – General Subjects. 1864 (4), 129521 (2020).
- Godoy, A. S., et al. Crystal structure of Zika virus NS5 RNA-dependent RNA polymerase. Nature Communications. 8, 14764 (2017).
- Yin, Z., et al. An adenosine nucleoside inhibitor of dengue virus. Proceedings of the National Academy of Sciences. 106 (48), 20435-20439 (2009).
- Zhang, J. H., Chung, T. D. Y., Oldenburg, K. R. A simple statistical parameter for use in evaluation and validation of high throughput screening assays. Journal of Biomolecular Screening. 4 (2), 67-73 (1999).
- Brecher, M., Zhang, J., Li, H. The flavivirus protease as a target for drug discovery. Virologica Sinica. 28 (6), 326-336 (2013).
- Noble, C. G., Seh, C. C., Chao, A. T., Shi, P. Y. Ligand-bound structures of the dengue virus protease reveal the active conformation. Journal of Virology. 86 (1), 438-446 (2012).
- Chen, X., et al. Mechanisms of activation and inhibition of Zika virus NS2B-NS3 protease. Cell Research. 26 (11), 1260-1263 (2016).
- Eyer, L., Nencka, R., de Clercq, E., Seley-Radtke, K., Růžek, D. Nucleoside analogs as a rich source of antiviral agents active against arthropod-borne flaviviruses. Antiviral Chemistry and Chemotherapy. 26, (2018).
- Xie, X., et al. Zika Virus Replicons for Drug Discovery. EBioMedicine. 12, 156-160 (2016).
- Pan, K. L., Lee, J. C., Sung, H. W., Chang, T. Y., Hsu, J. T. A. Development of NS3/4A protease-based reporter assay suitable for efficiently assessing hepatitis C virus infection. Antimicrobial Agents and Chemotherapy. 53 (11), 4825-4834 (2009).
- Khumthong, R., Angsuthanasombat, C., Panyim, S., Katzenmeier, G. In Vitro Determination of Dengue Virus Type 2 NS2B-NS3 Protease Activity with Fluorescent Peptide Substrates. Journal of Biochemistry and Molecular Biology. 35 (2), (2002).
- Ulanday, G. E. L., Okamoto, K., Morita, K. Development and utility of an in vitro, fluorescence-based assay for the discovery of novel compounds against dengue 2 viral protease. Tropical Medicine and Health. 44 (1), 1-10 (2016).
- Ong, I. L. H., Yang, K. L. Recent developments in protease activity assays and sensors. Analyst. 142 (11), 1867-1881 (2017).
- Eltahla, A. A., Lackovic, K., Marquis, C., Eden, J. S., White, P. A. A fluorescence-based high-throughput screen to identify small compound inhibitors of the genotype 3a hepatitis c virus RNA polymerase. Journal of Biomolecular Screening. 18 (9), 1027-1034 (2013).
- Eydoux, C., et al. A fluorescence-based high throughput-screening assay for the SARS-CoV RNA synthesis complex. Journal of Virological Methods. 288, 114013 (2021).
- Shimizu, H., et al. Discovery of a small molecule inhibitor targeting dengue virus NS5 RNA-dependent RNA polymerase. PLoS Neglected Tropical Diseases. 13 (11), 1-21 (2019).
- Sáez-Álvarez, Y., Arias, A., del Águila, C., Agudo, R. Development of a fluorescence-based method for the rapid determination of Zika virus polymerase activity and the screening of antiviral drugs. Scientific Reports. 9 (1), 1-11 (2019).
- Kocabas, F., Turan, R. D., Aslan, G. S. Fluorometric RdRp assay with self-priming RNA. Virus Genes. 50 (3), 498-504 (2015).
- Niyomrattanakit, P., et al. A fluorescence-based alkaline phosphatase-coupled polymerase assay for identification of inhibitors of dengue virus RNA-Dependent RNA polymerase. Journal of Biomolecular Screening. 16 (2), 201-210 (2011).
- Simeonov, A., Davis, M. I. . Interference with Fluorescence and Absorbance Flow Chart Fluorescence Interferences. (Md). , 1-8 (2016).
- Genick, C. C., et al. Applications of biophysics in high- Throughput screening hit validation. Journal of Biomolecular Screening. 19 (5), 707-714 (2014).
- Smith, T. M., et al. Identifying initiation and elongation inhibitors of dengue virus RNA polymerase in a high-throughput lead-finding campaign. Journal of Biomolecular Screening. 20 (1), 153-163 (2015).
- Porecha, R., Herschlag, D. RNA radiolabeling. Methods in enzymology. 530, 255-279 (2013).
