Pinces magnétiques à grande vitesse pour les mesures nanomécaniques sur des éléments sensibles à la force
1Department of Physics,Pohang University of Science and Technology (POSTECH), 2School of Biological Sciences,Seoul National University, 3Institute for Molecular Biology and Genetics,Seoul National University, 4School of Interdisciplinary Bioscience and Bioengineering,Pohang University of Science and Technology (POSTECH)
Summary
Ici, nous décrivons une pince magnétique à haute vitesse qui effectue des mesures nanomécaniques sur des biomolécules sensibles à la force à la vitesse maximale de 1,2 kHz. Nous introduisons son application aux épingles à cheveux à ADN et aux complexes SNARE en tant que systèmes modèles, mais elle sera également applicable à d’autres molécules impliquées dans des événements mécanobiologiques.
Abstract
Les pincettes magnétiques à molécule unique (MT) ont servi d’outils puissants pour interroger avec force les biomolécules, telles que les acides nucléiques et les protéines, et sont donc sur le point d’être utiles dans le domaine de la mécanobiologie. Étant donné que la méthode repose généralement sur le suivi des billes magnétiques basé sur l’image, la limite de vitesse dans l’enregistrement et l’analyse des images, ainsi que les fluctuations thermiques des billes, ont longtemps entravé son application dans l’observation de changements structurels petits et rapides dans les molécules cibles. Cet article décrit en détail les méthodes de construction et d’exploitation d’une installation de traduction automatique à haute résolution capable de résoudre la dynamique nanométrique en millisecondes des biomolécules et de leurs complexes. À titre d’exemples d’application, des expériences avec des épingles à cheveux à ADN et des complexes SNARE (machinerie de fusion membranaire) sont démontrées, en se concentrant sur la façon dont leurs états transitoires et transitions peuvent être détectés en présence de forces à l’échelle du piconewton. Nous nous attendons à ce que les MT à grande vitesse continuent de permettre des mesures nanomécaniques de haute précision sur des molécules qui détectent, transmettent et génèrent des forces dans les cellules, approfondissant ainsi notre compréhension moléculaire de la mécanobiologie.
Introduction
Les cellules détectent activement les stimuli mécaniques et y répondent. Ce faisant, de nombreuses biomolécules présentent des propriétés dépendantes de la force qui permettent des changements structurels dynamiques. Des exemples très appréciés incluent les canaux ioniques mécanosensibles et les éléments cytosquelettiques qui fournissent aux cellules des informations mécaniques clés de leur environnement.
En outre, les molécules qui présentent une nature unique de force porteuse peuvent également être considérées comme mécanosensibles dans un sens plus large. Par exemple, la formation locale et la fusion des duplex d’acides nucléiques, ainsi que des structures d’ordre supérieur telles que les quadriplex G, jouent un rôle crucial dans la réplication, la transcription, la recombinaison et, plus récemment, l’édition du génome. De plus, certaines protéines neuronales impliquées dans les communications synaptiques remplissent leurs fonctions en générant des forces physiques qui dépassent les niveaux des interactions intermoléculaires typiques. Quel que soit l’exemple étudié, l’étude de la nanomécanique des biomolécules impliquées avec une grande précision spatio-temporelle s’avérera très utile pour révéler les mécanismes moléculaires des processus mécanobiologiques associés 1,2,3.
Les méthodes de spectroscopie de force à molécule unique ont servi d’outils puissants pour examiner les propriétés mécaniques des biomolécules 2,4,5,6. Ils peuvent surveiller les changements structurels dans les acides nucléiques et les protéines en même temps que l’application de la force, examinant ainsi les propriétés dépendantes de la force. Deux configurations bien connues sont les pinces optiques et les pinces magnétiques (MT), qui utilisent des billes de la taille d’un micron pour manipuler les molécules 5,6,7,8. Dans ces plateformes, le polystyrène (pour les pinces optiques) ou les billes magnétiques (pour les MT) sont attachés à des molécules cibles (p. ex. acides nucléiques et protéines) via des « poignées » moléculaires, généralement constituées de courts fragments d’ADN double brin (ADNds). Les billes sont ensuite déplacées pour exercer une force et imagées pour suivre leurs emplacements qui signalent les changements structurels dans les molécules cibles. Les pinces optiques et magnétiques sont largement interchangeables dans leurs applications, mais il existe des différences importantes dans leurs approches du contrôle de la force. Les pincettes optiques sont intrinsèquement des instruments de serrage de position qui emprisonnent les billes en position, à cause desquelles la force appliquée fluctue lorsqu’une construction cible subit des changements de forme; L’augmentation de l’extension, par exemple en se dépliant, desserre l’attache et réduit la tension, et vice versa. Bien que la rétroaction active puisse être mise en œuvre pour contrôler la force dans les pincettes optiques, les MT en revanche fonctionnent naturellement comme un dispositif de serrage de force, tirant parti des forces magnétiques stables et éloignées des aimants permanents, qui peuvent également résister à la perturbation de l’environnement.
Malgré leur longue histoire et leur conception simple, les MT ont pris du retard par rapport aux pincettes optiques dans leurs applications pour les mesures de haute précision, en grande partie en raison des défis techniques liés au suivi rapide des talons. Récemment, cependant, plusieurs groupes ont mené conjointement une amélioration multidimensionnelle du matériel et des logiciels pour les instruments de traduction automatique 2,9,10,11,12,13,14,15,16,17,18,19 . Dans ce travail, nous présentons un exemple d’une telle configuration fonctionnant à 1,2 kHz et décrivons comment l’utiliser pour effectuer des mesures nanomécaniques sur des biomolécules sensibles à la force. En tant que systèmes modèles, nous utilisons des épingles à cheveux à ADN et des complexes SNARE neuronaux et examinons leurs changements structurels rapides dans le régime piconewton. Les épingles à cheveux ADN présentent des transitions simples à deux états dans une plage de force bien définie20,21, et servent donc de modèles de jouets pour vérifier les performances d’une pince à épiler. Comme les protéines SNARE s’assemblent en un complexe sensible aux forces qui entraîne la fusion membranaire22, elles ont également été étudiées de manière approfondie par spectroscopie de force à molécule unique 14,23,24,25. Les approches standard pour analyser les données et extraire des informations utiles sur la thermodynamique et la cinétique sont présentées. Nous espérons que cet article facilitera l’adoption de MT de haute précision dans les études mécanobiologiques et motivera les lecteurs à explorer leurs propres systèmes d’intérêt sensibles à la force.
Protocol
Tous les matériaux et équipements décrits dans ce protocole sont énumérés dans le tableau des matériaux. Le logiciel LabVIEW permettant de faire fonctionner la configuration de traduction automatique à grande vitesse décrite ci-dessous, ainsi que les scripts MATLAB permettant d’analyser des exemples de données, sont déposés sur GitHub (https://github.com/ShonLab/Magnetic-Tweezers) et accessibles au public. 1. Construction de l’appareil <p cla…
Representative Results
Calibrage de la forceLes résultats des deux méthodes de mesure de la force (variance de déplacement latéral des billes et analyse du spectre de puissance) différaient de 0 à 2 pN (figure 2G). Selon les résultats de la figure 2F, nous pouvons atteindre de manière fiable jusqu’à 30 pN avec des aimants en néodyme réguliers. Transitions à deux états d’une épingle à cheveux ADN de 8 pb</stron…
Discussion
Dans ce travail, nous avons introduit une configuration de spectroscopie de force à molécule unique qui peut observer les changements structurels des biomolécules avec une grande précision spatio-temporelle. La caméra CMOS haute vitesse utilisée acquiert 1 200 images s−1 à une résolution de 1 280 x 1 024, permettant un suivi des billes de 1,2 kHz. Cependant, la vitesse des mesures est actuellement limitée par le logiciel de suivi des perles, de sorte que le retour sur investissement est généraleme…
Divulgaciones
The authors have nothing to disclose.
Acknowledgements
Ce travail a été soutenu par la subvention de la Fondation nationale de recherche de Corée (NRF) financée par le gouvernement coréen (MSIT) (NRF-2022R1C1C1012176, NRF-2021R1A4A1031754 et NRF- 2021R1A6A1A10042944). S.-H.R. a été soutenu par la subvention NRF (2021R1C1C2009717).
Materials
| Materials for construct synthesis | |||
| Agarose gel electrophoresis system | Advance | Mupid-2plus | |
| DNA ladder | Bioneer | D-1037 | |
| nTaq polymerase | Enzynomics | P050A | |
| PCR purification kit | LaboPass | CMR0112 | |
| PEGylated SMCC crosslinker / SM(PEG)2 | ThermoFisher Scientific | 22102 | For SNARE–DNA coupling |
| Primer B | Bioneer | 5'-Biotin/TCGCCACCATCATTTCCA-3' | For 5-kbp force calibration construct and DNA handles |
| Primer B_hp | IDT | 5'-Biotin/TTTTTTTTTTGTTCTCTATTT TTTTAGAGAAC /AP site/ /AP site/ TCGCCACCATCATTTCCA-3' |
For hairpin construct |
| Primer N | Bioneer | 5'-C6Amine/CATGTGGGTGACGCGAAA-3' | For DNA handles |
| Primer Z | Bioneer | 5'-Azide/TCGCCACCATCATTTCCA-3' | For DNA handles |
| Primer Z_5k | Bioneer | 5'-Azide/TTAGAGAGTATGGGTATATGACA TCG-3' |
For 5-kbp force calibration construct |
| Primer Z_hp | Bioneer | 5'-Azide/GTGGCAGCATGACACC-3' | For hairpin construct |
| SYBR Safe DNA Gel Stain | ThermoFisher Scientific | S33102 | |
| λ-DNA | Bioneer | D-2510 | Template strand for PCR |
| DNA sequences for SNARE proteins | |||
| 6×His-tagged SNAP-25b (2-206; capitalized) in pET28a | homemade | tggcgaatgggacgcgccctgtagcggcgca ttaagcgcggcgggtgtggtggttacgcgca gcgtgaccgctacacttgccagcgccctagc gcccgctcctttcgctttcttcccttccttt ctcgccacgttcgccggctttccccgtcaag ctctaaatcgggggctccctttagggttccg atttagtgctttacggcacctcgaccccaaa aaacttgattagggtgatggttcacgtagtg ggccatcgccctgatagacggtttttcgccc tttgacgttggagtccacgttctttaatagt ggactcttgttccaaactggaacaacactca accctatctcggtctattcttttgatttata agggattttgccgatttcggcctattggtta aaaaatgagctgatttaacaaaaatttaacg cgaattttaacaaaatattaacgtttacaat ttcaggtggcacttttcggggaaatgtgcgc ggaacccctatttgtttatttttctaaatac attcaaatatgtatccgctcatgaattaatt cttagaaaaactcatcgagcatcaaatgaaa ctgcaatttattcatatcaggattatcaata ccatatttttgaaaaagccgtttctgtaatg aaggagaaaactcaccgaggcagttccatag gatggcaagatcctggtatcggtctgcgatt ccgactcgtccaacatcaatacaacctatta atttcccctcgtcaaaaataaggttatcaag tgagaaatcaccatgagtgacgactgaatcc ggtgagaatggcaaaagtttatgcatttctt tccagacttgttcaacaggccagccattacg ctcgtcatcaaaatcactcgcatcaaccaaa ccgttattcattcgtgattgcgcctgagcga gacgaaatacgcgatcgctgttaaaaggaca attacaaacaggaatcgaatgcaaccggcgc aggaacactgccagcgcatcaacaatatttt cacctgaatcaggatattcttctaatacctg gaatgctgttttcccggggatcgcagtggtg agtaaccatgcatcatcaggagtacggataa aatgcttgatggtcggaagaggcataaattc cgtcagccagtttagtctgaccatctcatct gtaacatcattggcaacgctacctttgccat gtttcagaaacaactctggcgcatcgggctt cccatacaatcgatagattgtcgcacctgat tgcccgacattatcgcgagcccatttatacc catataaatcagcatccatgttggaatttaa tcgcggcctagagcaagacgtttcccgttga atatggctcataacaccccttgtattactgt ttatgtaagcagacagttttattgttcatga ccaaaatcccttaacgtgagttttcgttcca ctgagcgtcagaccccgtagaaaagatcaaa ggatcttcttgagatcctttttttctgcgcg taatctgctgcttgcaaacaaaaaaaccacc gctaccagcggtggtttgtttgccggatcaa gagctaccaactctttttccgaaggtaactg gcttcagcagagcgcagataccaaatactgt ccttctagtgtagccgtagttaggccaccac ttcaagaactctgtagcaccgcctacatacc tcgctctgctaatcctgttaccagtggctgc tgccagtggcgataagtcgtgtcttaccggg ttggactcaagacgatagttaccggataagg cgcagcggtcgggctgaacggggggttcgtg cacacagcccagcttggagcgaacgacctac accgaactgagatacctacagcgtgagctat gagaaagcgccacgcttcccgaagggagaaa ggcggacaggtatccggtaagcggcagggtc ggaacaggagagcgcacgagggagcttcca gggggaaacgcctggtatctttatagtcctgt cgggtttcgccacctctgacttgagcgtcga tttttgtgatgctcgtcaggggggcggagcc tatggaaaaacgccagcaacgcggccttttt acggttcctggccttttgctggccttttgct cacatgttctttcctgcgttatcccctgatt ctgtggataaccgtattaccgcctttgagtg agctgataccgctcgccgcagccgaacgacc gagcgcagcgagtcagtgagcgaggaagcgg aagagcgcctgatgcggtattttctccttac gcatctgtgcggtatttcacaccgcatatat ggtgcactctcagtacaatctgctctgatgc cgcatagttaagccagtatacactccgctat cgctacgtgactgggtcatggctgcgccccg acacccgccaacacccgctgacgcgccctga cgggcttgtctgctcccggcatccgcttaca gacaagctgtgaccgtctccgggagctgcat gtgtcagaggttttcaccgtcatcaccgaaa cgcgcgaggcagctgcggtaaagctcatcag cgtggtcgtgaagcgattcacagatgtctgc ctgttcatccgcgtccagctcgttgagtttc tccagaagcgttaatgtctggcttctgataa agcgggccatgttaagggcggttttttcctg tttggtcactgatgcctccgtgtaaggggga tttctgttcatgggggtaatgataccgatga aacgagagaggatgctcacgatacgggttac tgatgatgaacatgcccggttactggaacgt tgtgagggtaaacaactggcggtatggatgc ggcgggaccagagaaaaatcactcagggtc aatgccagcgcttcgttaatacagatgtaggt gttccacagggtagccagcagcatcctgcga tgcagatccggaacataatggtgcagggcgc tgacttccgcgtttccagactttacgaaaca cggaaaccgaagaccattcatgttgttgctc aggtcgcagacgttttgcagcagcagtcgct tcacgttcgctcgcgtatcggtgattcattc tgctaaccagtaaggcaaccccgccagccta gccgggtcctcaacgacaggagcacgatcat gcgcacccgtggggccgccatgccggcgata atggcctgcttctcgccgaaacgtttggtgg cgggaccagtgacgaaggcttgagcgagggc gtgcaagattccgaataccgcaagcgacagg ccgatcatcgtcgcgctccagcgaaagcggt cctcgccgaaaatgacccagagcgctgccgg cacctgtcctacgagttgcatgataaagaag acagtcataagtgcggcgacgatagtcatgc cccgcgcccaccggaaggagctgactgggtt gaaggctctcaagggcatcggtcgagatccc ggtgcctaatgagtgagctaacttacattaa ttgcgttgcgctcactgcccgctttccagtc gggaaacctgtcgtgccagctgcattaatga atcggccaacgcgcggggagaggcggtttgc gtattgggcgccagggtggtttttcttttca ccagtgagacgggcaacagctgattgccctt caccgcctggccctgagagagttgcagcaag cggtccacgctggtttgccccagcaggcgaa aatcctgtttgatggtggttaacggcgggat ataacatgagctgtcttcggtatcgtcgtat cccactaccgagatatccgcaccaacgcgca gcccggactcggtaatggcgcgcattgcgcc cagcgccatctgatcgttggcaaccagcatc gcagtgggaacgatgccctcattcagcattt gcatggtttgttgaaaaccggacatggcact ccagtcgccttcccgttccgctatcggctga atttgattgcgagtgagatatttatgccagc cagccagacgcagacgcgccgagacagaa cttaatgggcccgctaacagcgcgatttgctgg tgacccaatgcgaccagatgctccacgccca gtcgcgtaccgtcttcatgggagaaaataat actgttgatgggtgtctggtcagagacatca agaaataacgccggaacattagtgcaggcag cttccacagcaatggcatcctggtcatccag cggatagttaatgatcagcccactgacgcgt tgcgcgagaagattgtgcaccgccgctttac aggcttcgacgccgcttcgttctaccatcga caccaccacgctggcacccagttgatcggcg cgagatttaatcgccgcgacaatttgcgacg gcgcgtgcagggccagactggaggtggcaac gccaatcagcaacgactgtttgcccgccagt tgttgtgccacgcggttgggaatgtaattca gctccgccatcgccgcttccactttttcccg cgttttcgcagaaacgtggctggcctggttc accacgcgggaaacggtctgataagagacac cggcatactctgcgacatcgtataacgttac tggtttcacattcaccaccctgaattgactc tcttccgggcgctatcatgccataccgcgaa aggttttgcgccattcgatggtgtccgggat ctcgacgctctcccttatgcgactcctgcat taggaagcagcccagtagtaggttgaggccg ttgagcaccgccgccgcaaggaatggtgcat gcaaggagatggcgcccaacagtcccccggc cacggggcctgccaccatacccacgccgaaa caagcgctcatgagcccgaagtggcgagccc gatcttccccatcggtgatgtcggcgatata ggcgccagcaaccgcacctgtggcgccggtg atgccggccacgatgcgtccggcgtagagga tcgagatctcgatcccgcgaaattaatacga ctcactataggggaattgtgagcggataaca attcccctctagaaataattttgtttaactt taagaaggagatataccATGGGCAGC AGCCATCATCATCATCATCACA GCAGCGGCCTGGTGCCGCGC GGCAGCCATACTAGCGGAGAT ATCGCCGAGGACGCAGACAT GCGCAATGAGCTGGAGGAGA TGCAGAGGAGGGCTGACCAG CTGGCTGATGAGTCCCTGGA AAGCACCCGTCGCATGCTGC AGCTGGTTGAAGAGAGTAAA GATGCTGGCATCAGGACTTT GGTTATGTTGGATGAGCAAG GCGAACAACTGGAACGCATT GAGGAAGGGATGGACCAAAT CAATAAGGACATGAAAGAAG CAGAAAAGAATTTGACGGAC CTAGGAAAATTCGCCGGCCT TGCCGTGGCCCCCGCCAAC AAGCTTAAATCCAGTGATGC TTACAAAAAAGCCTGGGGC AATAATCAGGATGGAGTAGT GGCCAGCCAGCCTGCCCG TGTGGTGGATGAACGGGAG CAGATGGCCATCAGTGGTG GCTTCATCCGCAGGGTAAC AAATGATGCCCGGGAAAAT GAGATGGATGAGAACCTG GAGCAGGTGAGCGGCATC ATCGGAAACCTCCGCCAC ATGGCTCTAGACATGGGCA ATGAGATTGACACCCAGA ATCGCCAGATCGACAGGA TCATGGAGAAGGCTGATT CCAACAAAACCAGAATTG ATGAAGCCAACCAACGTG CAACAAAGATGCTGGGAA GTGGTTAAggatccgaattcgag ctccgtcgacaagcttgcggccgcactc gagcaccaccaccaccaccactgagat ccggctgctaacaaagcccgaaagga agctgagttggctgctgccaccgctgag caataactagcataaccccttggggcct ctaaacgggtcttgaggggttttttgctga aaggaggaactatatccggat |
|
| 6×His-tagged VAMP2 (2-97, L32C/I97C; capitalized) in pET28a | homemade | tggcgaatgggacgcgccctgtagcggcgca ttaagcgcggcgggtgtggtggttacgcgca gcgtgaccgctacacttgccagcgccctagc gcccgctcctttcgctttcttcccttccttt ctcgccacgttcgccggctttccccgtcaag ctctaaatcgggggctccctttagggttccg atttagtgctttacggcacctcgaccccaaa aaacttgattagggtgatggttcacgtagtg ggccatcgccctgatagacggtttttcgccc tttgacgttggagtccacgttctttaatagt ggactcttgttccaaactggaacaacactca accctatctcggtctattcttttgatttata agggattttgccgatttcggcctattggtta aaaaatgagctgatttaacaaaaatttaacg cgaattttaacaaaatattaacgtttacaat ttcaggtggcacttttcggggaaatgtgcgc ggaacccctatttgtttatttttctaaatac attcaaatatgtatccgctcatgaattaatt cttagaaaaactcatcgagcatcaaatgaaa ctgcaatttattcatatcaggattatcaata ccatatttttgaaaaagccgtttctgtaatg aaggagaaaactcaccgaggcagttccatag gatggcaagatcctggtatcggtctgcgatt ccgactcgtccaacatcaatacaacctatta atttcccctcgtcaaaaataaggttatcaag tgagaaatcaccatgagtgacgactgaatcc ggtgagaatggcaaaagtttatgcatttctt tccagacttgttcaacaggccagccattacg ctcgtcatcaaaatcactcgcatcaaccaaa ccgttattcattcgtgattgcgcctgagcga gacgaaatacgcgatcgctgttaaaaggaca attacaaacaggaatcgaatgcaaccggcgc aggaacactgccagcgcatcaacaatatttt cacctgaatcaggatattcttctaatacctg gaatgctgttttcccggggatcgcagtggtg agtaaccatgcatcatcaggagtacggataa aatgcttgatggtcggaagaggcataaattc cgtcagccagtttagtctgaccatctcatct gtaacatcattggcaacgctacctttgccat gtttcagaaacaactctggcgcatcgggctt cccatacaatcgatagattgtcgcacctgat tgcccgacattatcgcgagcccatttatacc catataaatcagcatccatgttggaatttaa tcgcggcctagagcaagacgtttcccgttga atatggctcataacaccccttgtattactgt ttatgtaagcagacagttttattgttcatga ccaaaatcccttaacgtgagttttcgttcca ctgagcgtcagaccccgtagaaaagatcaaa ggatcttcttgagatcctttttttctgcgcg taatctgctgcttgcaaacaaaaaaaccacc gctaccagcggtggtttgtttgccggatcaa gagctaccaactctttttccgaaggtaactg gcttcagcagagcgcagataccaaatactgt ccttctagtgtagccgtagttaggccaccac ttcaagaactctgtagcaccgcctacatacc tcgctctgctaatcctgttaccagtggctgc tgccagtggcgataagtcgtgtcttaccggg ttggactcaagacgatagttaccggataagg cgcagcggtcgggctgaacggggggttcgtg cacacagcccagcttggagcgaacgacctac accgaactgagatacctacagcgtgagctatg agaaagcgccacgcttcccgaagggagaaa ggcggacaggtatccggtaagcggcagggtc ggaacaggagagcgcacgagggagcttcca gggggaaacgcctggtatctttatagtcctgt cgggtttcgccacctctgacttgagcgtcga tttttgtgatgctcgtcaggggggcggagcc tatggaaaaacgccagcaacgcggccttttt acggttcctggccttttgctggccttttgct cacatgttctttcctgcgttatcccctgatt ctgtggataaccgtattaccgcctttgagtg agctgataccgctcgccgcagccgaacgacc gagcgcagcgagtcagtgagcgaggaagc ggaagagcgcctgatgcggtattttctccttac gcatctgtgcggtatttcacaccgcatatat ggtgcactctcagtacaatctgctctgatgc cgcatagttaagccagtatacactccgctat cgctacgtgactgggtcatggctgcgccccg acacccgccaacacccgctgacgcgccctga cgggcttgtctgctcccggcatccgcttaca gacaagctgtgaccgtctccgggagctgcat gtgtcagaggttttcaccgtcatcaccgaaa cgcgcgaggcagctgcggtaaagctcatcag cgtggtcgtgaagcgattcacagatgtctgc ctgttcatccgcgtccagctcgttgagtttc tccagaagcgttaatgtctggcttctgataa agcgggccatgttaagggcggttttttcctg tttggtcactgatgcctccgtgtaaggggga tttctgttcatgggggtaatgataccgatga aacgagagaggatgctcacgatacgggttac tgatgatgaacatgcccggttactggaacgt tgtgagggtaaacaactggcggtatggatgc ggcgggaccagagaaaaatcactcagggtc aatgccagcgcttcgttaatacagatgtaggt gttccacagggtagccagcagcatcctgcga tgcagatccggaacataatggtgcagggcgc tgacttccgcgtttccagactttacgaaaca cggaaaccgaagaccattcatgttgttgctc aggtcgcagacgttttgcagcagcagtcgct tcacgttcgctcgcgtatcggtgattcattc tgctaaccagtaaggcaaccccgccagccta gccgggtcctcaacgacaggagcacgatcat gcgcacccgtggggccgccatgccggcgata atggcctgcttctcgccgaaacgtttggtgg cgggaccagtgacgaaggcttgagcgagggc gtgcaagattccgaataccgcaagcgacagg ccgatcatcgtcgcgctccagcgaaagcggt cctcgccgaaaatgacccagagcgctgccgg cacctgtcctacgagttgcatgataaagaag acagtcataagtgcggcgacgatagtcatgc cccgcgcccaccggaaggagctgactgggtt gaaggctctcaagggcatcggtcgagatccc ggtgcctaatgagtgagctaacttacattaa ttgcgttgcgctcactgcccgctttccagtc gggaaacctgtcgtgccagctgcattaatga atcggccaacgcgcggggagaggcggtttgc gtattgggcgccagggtggtttttcttttca ccagtgagacgggcaacagctgattgccctt caccgcctggccctgagagagttgcagcaag cggtccacgctggtttgccccagcaggcgaa aatcctgtttgatggtggttaacggcgggat ataacatgagctgtcttcggtatcgtcgtat cccactaccgagatatccgcaccaacgcgca gcccggactcggtaatggcgcgcattgcgcc cagcgccatctgatcgttggcaaccagcatc gcagtgggaacgatgccctcattcagcattt gcatggtttgttgaaaaccggacatggcact ccagtcgccttcccgttccgctatcggctga atttgattgcgagtgagatatttatgccagc cagccagacgcagacgcgccgagacagaa cttaatgggcccgctaacagcgcgatttgctgg tgacccaatgcgaccagatgctccacgccca gtcgcgtaccgtcttcatgggagaaaataat actgttgatgggtgtctggtcagagacatca agaaataacgccggaacattagtgcaggcag cttccacagcaatggcatcctggtcatccag cggatagttaatgatcagcccactgacgcgt tgcgcgagaagattgtgcaccgccgctttac aggcttcgacgccgcttcgttctaccatcga caccaccacgctggcacccagttgatcggcg cgagatttaatcgccgcgacaatttgcgacg gcgcgtgcagggccagactggaggtggcaac gccaatcagcaacgactgtttgcccgccagt tgttgtgccacgcggttgggaatgtaattca gctccgccatcgccgcttccactttttcccg cgttttcgcagaaacgtggctggcctggttc accacgcgggaaacggtctgataagagacac cggcatactctgcgacatcgtataacgttac tggtttcacattcaccaccctgaattgactc tcttccgggcgctatcatgccataccgcgaa aggttttgcgccattcgatggtgtccgggat ctcgacgctctcccttatgcgactcctgcat taggaagcagcccagtagtaggttgaggccg ttgagcaccgccgccgcaaggaatggtgcat gcaaggagatggcgcccaacagtcccccggc cacggggcctgccaccatacccacgccgaaa caagcgctcatgagcccgaagtggcgagccc gatcttccccatcggtgatgtcggcgatata ggcgccagcaaccgcacctgtggcgccggtg atgccggccacgatgcgtccggcgtagagga tcgagatctcgatcccgcgaaattaatacga ctcactataggggaattgtgagcggataaca attcccctctagaaataattttgtttaactt taagaaggagatataccATGGGCAGC AGCCATCATCATCATCATCAC AGCAGCGGCCTGGTGCCGC GCGGCAGCCATATGGCAGAT CTCTCGGCTACCGCTGCCAC CGTCCCGCCTGCCGCCCCG GCCGGCGAGGGTGGCCCCC CTGCACCTCCTCCAAATCTTA CCAGTAACAGGAGATGCCAG CAGACCCAGGCCCAGGTGG ATGAGGTGGTGGACATCATG AGGGTGAATGTGGACAAGGT CCTGGAGCGAGACCAGAAG CTATCGGAACTGGATGATCG CGCAGATGCCCTCCAGGCA GGGGCCTCCCAGTTTGAAA CAAGTGCAGCCAAGCTCAA GCGCAAATACTGGTGGAAA AACCTCAAGATGATGTGCTA Aggatccgaattcgagctccgtcg acaagcttgcggccgcactcgagcaccacca ccaccaccactgagatccggctgctaacaaa gcccgaaaggaagctgagttggctgctgcca ccgctgagcaataactagcataaccccttgg ggcctctaaacgggtcttgaggggttttttg ctgaaaggaggaactatatccggat |
|
| 6×His-tagged ΔN-VAMP2 (49–96; capitalized) and Syntaxin-1A (191–267, I202C/I266C; capitalized) in pETDuet-1 | homemade | ggggaattgtgagcggataacaattcccctc tagaaataattttgtttaactttaagaagga gatataccATGGGCAGCAGCCATCA TCATCATCATCACAGCAGCGG CCTGGAAGTTCTGTTCCAGGG GCCCGGTAATGTGGACAAGGT CCTGGAGCGAGACCAGAAGCT ATCGGAACTGGATGATCGCGC AGATGCCCTCCAGGCAGGGGC CTCCCAGTTTGAAACAAGTGC AGCCAAGCTCAAGCGCAAATAC TGGTGGAAAAACCTCAAGATGAT GTAAgcggccgcataatgcttaagtcgaaca gaaagtaatcgtattgtacacggccgcataa tcgaaattaatacgactcactataggggaat tgtgagcggataacaattccccatcttagta tattagttaagtataagaaggagatatacat ATGGCCCTCAGTGAGATCGAGA CCAGGCACAGTGAGTGCATC AAGTTGGAGAACAGCATCCG GGAGCTACACGATATGTTCAT GGACATGGCCATGCTGGTGG AGAGCCAGGGGGAGATGATT GACAGGATCGAGTACAATGTG GAACACGCTGTGGACTACGTG GAGAGGGCCGTGTCTGACACC AAGAAGGCCGTCAAGTACCAG AGCAAGGCACGCAGGAAGAA GTGCATGATCTAActcgagtc tggtaaagaaaccgctgctgcgaaatttgaa cgccagcacatggactcgtctactagcgcag cttaattaacctaggctgctgccaccgctga gcaataactagcataaccccttggggcctct aaacgggtcttgaggggttttttgctgaaag gaggaactatatccggattggcgaatgggac gcgccctgtagcggcgcattaagcgcggcgg gtgtggtggttacgcgcagcgtgaccgctac acttgccagcgccctagcgcccgctcctttc gctttcttcccttcctttctcgccacgttcg ccggctttccccgtcaagctctaaatcgggg gctccctttagggttccgatttagtgcttta cggcacctcgaccccaaaaaacttgattagg gtgatggttcacgtagtgggccatcgccctg atagacggtttttcgccctttgacgttggag tccacgttctttaatagtggactcttgttcc aaactggaacaacactcaaccctatctcggt ctattcttttgatttataagggattttgccg atttcggcctattggttaaaaaatgagctga tttaacaaaaatttaacgcgaattttaacaa aatattaacgtttacaatttctggcggcacg atggcatgagattatcaaaaaggatcttcac ctagatccttttaaattaaaaatgaagtttt aaatcaatctaaagtatatatgagtaaactt ggtctgacagttaccaatgcttaatcagtga ggcacctatctcagcgatctgtctatttcgt tcatccatagttgcctgactccccgtcgtgt agataactacgatacgggagggcttaccatc tggccccagtgctgcaatgataccgcgagac ccacgctcaccggctccagatttatcagcaa taaaccagccagccggaagggccgagcgca gaagtggtcctgcaactttatccgcctccatc cagtctattaattgttgccgggaagctagag taagtagttcgccagttaatagtttgcgcaa cgttgttgccattgctacaggcatcgtggtg tcacgctcgtcgtttggtatggcttcattca gctccggttcccaacgatcaaggcgagttac atgatcccccatgttgtgcaaaaaagcggtt agctccttcggtcctccgatcgttgtcagaa gtaagttggccgcagtgttatcactcatggt tatggcagcactgcataattctcttactgtc atgccatccgtaagatgcttttctgtgactg gtgagtactcaaccaagtcattctgagaata gtgtatgcggcgaccgagttgctcttgcccg gcgtcaatacgggataataccgcgccacata gcagaactttaaaagtgctcatcattggaaa acgttcttcggggcgaaaactctcaaggatc ttaccgctgttgagatccagttcgatgtaac ccactcgtgcacccaactgatcttcagcatc ttttactttcaccagcgtttctgggtgagcaaa aacaggaaggcaaaatgccgcaaaaaagg gaataagggcgacacggaaatgttgaatact catactcttcctttttcaatcatgattgaag catttatcagggttattgtctcatgagcgga tacatatttgaatgtatttagaaaaataaac aaataggtcatgaccaaaatcccttaacgtg agttttcgttccactgagcgtcagaccccgt agaaaagatcaaaggatcttcttgagatcct ttttttctgcgcgtaatctgctgcttgcaaa caaaaaaaccaccgctaccagcggtggtttg tttgccggatcaagagctaccaactcttttt ccgaaggtaactggcttcagcagagcgcaga taccaaatactgtccttctagtgtagccgta gttaggccaccacttcaagaactctgtagca ccgcctacatacctcgctctgctaatcctgt taccagtggctgctgccagtggcgataagtc gtgtcttaccgggttggactcaagacgatag ttaccggataaggcgcagcggtcgggctgaa cggggggttcgtgcacacagcccagcttgga gcgaacgacctacaccgaactgagataccta cagcgtgagctatgagaaagcgccacgcttccc gaagggagaaaggcggacaggtatccggta agcggcagggtcggaacaggagagcgcac gagggagcttccagggggaaacgcctggtatc tttatagtcctgtcgggtttcgccacctctg acttgagcgtcgatttttgtgatgctcgtca ggggggcggagcctatggaaaaacgccagc aacgcggcctttttacggttcctggccttttg ctggccttttgctcacatgttctttcctgcg ttatcccctgattctgtggataaccgtatta ccgcctttgagtgagctgataccgctcgccgc agccgaacgaccgagcgcagcgagtcagtg agcgaggaagcggaagagcgcctgatgcgg tattttctccttacgcatctgtgcggtatttc acaccgcatatatggtgcactctcagtacaa tctgctctgatgccgcatagttaagccagta tacactccgctatcgctacgtgactgggtca tggctgcgccccgacacccgccaacacccgc tgacgcgccctgacgggcttgtctgctcccg gcatccgcttacagacaagctgtgaccgtct ccgggagctgcatgtgtcagaggttttcacc gtcatcaccgaaacgcgcgaggcagctgcgg taaagctcatcagcgtggtcgtgaagcgatt cacagatgtctgcctgttcatccgcgtccag ctcgttgagtttctccagaagcgttaatgtc tggcttctgataaagcgggccatgttaaggg cggttttttcctgtttggtcactgatgcctc cgtgtaagggggatttctgttcatgggggta atgataccgatgaaacgagagaggatgctca cgatacgggttactgatgatgaacatgcccg gttactggaacgttgtgagggtaaacaactg gcggtatggatgcggcgggaccagagaaaaa tcactcagggtcaatgccagcgcttcgttaa tacagatgtaggtgttccacagggtagccag cagcatcctgcgatgcagatccggaacataa tggtgcagggcgctgacttccgcgtttccag actttacgaaacacggaaaccgaagaccatt catgttgttgctcaggtcgcagacgttttgc agcagcagtcgcttcacgttcgctcgcgtat cggtgattcattctgctaaccagtaaggcaa ccccgccagcctagccgggtcctcaacgaca ggagcacgatcatgctagtcatgccccgcgc ccaccggaaggagctgactgggttgaaggct ctcaagggcatcggtcgagatcccggtgcct aatgagtgagctaacttacattaattgcgtt gcgctcactgcccgctttccagtcgggaaac ctgtcgtgccagctgcattaatgaatcggcc aacgcgcggggagaggcggtttgcgtattgg gcgccagggtggtttttcttttcaccagtga gacgggcaacagctgattgcccttcaccgcc tggccctgagagagttgcagcaagcggtcca cgctggtttgccccagcaggcgaaaatcctg tttgatggtggttaacggcgggatataacat gagctgtcttcggtatcgtcgtatcccacta ccgagatgtccgcaccaacgcgcagcccgga ctcggtaatggcgcgcattgcgcccagcgcc atctgatcgttggcaaccagcatcgcagtgg gaacgatgccctcattcagcatttgcatggt ttgttgaaaaccggacatggcactccagtcg ccttcccgttccgctatcggctgaatttgat tgcgagtgagatatttatgccagccagccag acgcagacgcgccgagacagaacttaatggg cccgctaacagcgcgatttgctggtgaccca atgcgaccagatgctccacgcccagtcgcgt accgtcttcatgggagaaaataatactgttg atgggtgtctggtcagagacatcaagaaata acgccggaacattagtgcaggcagcttccac agcaatggcatcctggtcatccagcggatag ttaatgatcagcccactgacgcgttgcgcga gaagattgtgcaccgccgctttacaggcttc gacgccgcttcgttctaccatcgacaccacc acgctggcacccagttgatcggcgcgagatt taatcgccgcgacaatttgcgacggcgcgtg cagggccagactggaggtggcaacgccaatc agcaacgactgtttgcccgccagttgttgtg ccacgcggttgggaatgtaattcagctccgc catcgccgcttccactttttcccgcgttttc gcagaaacgtggctggcctggttcaccacgc gggaaacggtctgataagagacaccggcata ctctgcgacatcgtataacgttactggtttc acattcaccaccctgaattgactctcttccg ggcgctatcatgccataccgcgaaaggtttt gcgccattcgatggtgtccgggatctcgacg ctctcccttatgcgactcctgcattaggaag cagcccagtagtaggttgaggccgttgagca ccgccgccgcaaggaatggtgcatgcaagga gatggcgcccaacagtcccccggccacgggg cctgccaccatacccacgccgaaacaagcgc tcatgagcccgaagtggcgagcccgatcttc cccatcggtgatgtcggcgatataggcgcca gcaaccgcacctgtggcgccggtgatgccgg ccacgatgcgtccggcgtagaggatcgagat cgatctcgatcccgcgaaattaatacgactc actata |
|
| SNAP-25b (1–206, all C to A; capitalized) in pET28a | homemade | tggcgaatgggacgcgccctgtagcggcgca ttaagcgcggcgggtgtggtggttacgcgca gcgtgaccgctacacttgccagcgccctagc gcccgctcctttcgctttcttcccttccttt ctcgccacgttcgccggctttccccgtcaag ctctaaatcgggggctccctttagggttccg atttagtgctttacggcacctcgaccccaaa aaacttgattagggtgatggttcacgtagtg ggccatcgccctgatagacggtttttcgccc tttgacgttggagtccacgttctttaatagt ggactcttgttccaaactggaacaacactca accctatctcggtctattcttttgatttata agggattttgccgatttcggcctattggtta aaaaatgagctgatttaacaaaaatttaacg cgaattttaacaaaatattaacgtttacaat ttcaggtggcacttttcggggaaatgtgcgc ggaacccctatttgtttatttttctaaatac attcaaatatgtatccgctcatgaattaatt cttagaaaaactcatcgagcatcaaatgaaa ctgcaatttattcatatcaggattatcaata ccatatttttgaaaaagccgtttctgtaatg aaggagaaaactcaccgaggcagttccatag gatggcaagatcctggtatcggtctgcgatt ccgactcgtccaacatcaatacaacctatta atttcccctcgtcaaaaataaggttatcaag tgagaaatcaccatgagtgacgactgaatcc ggtgagaatggcaaaagtttatgcatttctt tccagacttgttcaacaggccagccattacg ctcgtcatcaaaatcactcgcatcaaccaaa ccgttattcattcgtgattgcgcctgagcga gacgaaatacgcgatcgctgttaaaaggaca attacaaacaggaatcgaatgcaaccggcgc aggaacactgccagcgcatcaacaatatttt cacctgaatcaggatattcttctaatacctg gaatgctgttttcccggggatcgcagtggtg agtaaccatgcatcatcaggagtacggataa aatgcttgatggtcggaagaggcataaattc cgtcagccagtttagtctgaccatctcatct gtaacatcattggcaacgctacctttgccat gtttcagaaacaactctggcgcatcgggctt cccatacaatcgatagattgtcgcacctgat tgcccgacattatcgcgagcccatttatacc catataaatcagcatccatgttggaatttaa tcgcggcctagagcaagacgtttcccgttga atatggctcataacaccccttgtattactgt ttatgtaagcagacagttttattgttcatga ccaaaatcccttaacgtgagttttcgttcca ctgagcgtcagaccccgtagaaaagatcaaa ggatcttcttgagatcctttttttctgcgcg taatctgctgcttgcaaacaaaaaaaccacc gctaccagcggtggtttgtttgccggatcaa gagctaccaactctttttccgaaggtaactg gcttcagcagagcgcagataccaaatactgt ccttctagtgtagccgtagttaggccaccac ttcaagaactctgtagcaccgcctacatacc tcgctctgctaatcctgttaccagtggctgc tgccagtggcgataagtcgtgtcttaccggg ttggactcaagacgatagttaccggataagg cgcagcggtcgggctgaacggggggttcgtg cacacagcccagcttggagcgaacgacctac accgaactgagatacctacagcgtgagctatg agaaagcgccacgcttcccgaagggagaaa ggcggacaggtatccggtaagcggcagggtc ggaacaggagagcgcacgagggagcttcc agggggaaacgcctggtatctttatagtcctgt cgggtttcgccacctctgacttgagcgtcga tttttgtgatgctcgtcaggggggcggagcc tatggaaaaacgccagcaacgcggccttttt acggttcctggccttttgctggccttttgct cacatgttctttcctgcgttatcccctgatt ctgtggataaccgtattaccgcctttgagtg agctgataccgctcgccgcagccgaacgacc gagcgcagcgagtcagtgagcgaggaagc ggaagagcgcctgatgcggtattttctccttac gcatctgtgcggtatttcacaccgcatatat ggtgcactctcagtacaatctgctctgatgc cgcatagttaagccagtatacactccgctat cgctacgtgactgggtcatggctgcgccccg acacccgccaacacccgctgacgcgccctga cgggcttgtctgctcccggcatccgcttaca gacaagctgtgaccgtctccgggagctgcat gtgtcagaggttttcaccgtcatcaccgaaa cgcgcgaggcagctgcggtaaagctcatcag cgtggtcgtgaagcgattcacagatgtctgc ctgttcatccgcgtccagctcgttgagtttc tccagaagcgttaatgtctggcttctgataa agcgggccatgttaagggcggttttttcctg tttggtcactgatgcctccgtgtaaggggga tttctgttcatgggggtaatgataccgatga aacgagagaggatgctcacgatacgggttac tgatgatgaacatgcccggttactggaacgt tgtgagggtaaacaactggcggtatggatgc ggcgggaccagagaaaaatcactcagggtc aatgccagcgcttcgttaatacagatgtaggt gttccacagggtagccagcagcatcctgcga tgcagatccggaacataatggtgcagggcgc tgacttccgcgtttccagactttacgaaaca cggaaaccgaagaccattcatgttgttgctc aggtcgcagacgttttgcagcagcagtcgct tcacgttcgctcgcgtatcggtgattcattc tgctaaccagtaaggcaaccccgccagccta gccgggtcctcaacgacaggagcacgatcat gcgcacccgtggggccgccatgccggcgata atggcctgcttctcgccgaaacgtttggtgg cgggaccagtgacgaaggcttgagcgagggc gtgcaagattccgaataccgcaagcgacagg ccgatcatcgtcgcgctccagcgaaagcggt cctcgccgaaaatgacccagagcgctgccgg cacctgtcctacgagttgcatgataaagaag acagtcataagtgcggcgacgatagtcatgc cccgcgcccaccggaaggagctgactgggtt gaaggctctcaagggcatcggtcgagatccc ggtgcctaatgagtgagctaacttacattaa ttgcgttgcgctcactgcccgctttccagtc gggaaacctgtcgtgccagctgcattaatga atcggccaacgcgcggggagaggcggtttgc gtattgggcgccagggtggtttttcttttca ccagtgagacgggcaacagctgattgccctt caccgcctggccctgagagagttgcagcaag cggtccacgctggtttgccccagcaggcgaa aatcctgtttgatggtggttaacggcgggat ataacatgagctgtcttcggtatcgtcgtat cccactaccgagatatccgcaccaacgcgca gcccggactcggtaatggcgcgcattgcgcc cagcgccatctgatcgttggcaaccagcatc gcagtgggaacgatgccctcattcagcattt gcatggtttgttgaaaaccggacatggcact ccagtcgccttcccgttccgctatcggctga atttgattgcgagtgagatatttatgccagc cagccagacgcagacgcgccgagacagaa cttaatgggcccgctaacagcgcgatttgctgg tgacccaatgcgaccagatgctccacgccca gtcgcgtaccgtcttcatgggagaaaataat actgttgatgggtgtctggtcagagacatca agaaataacgccggaacattagtgcaggcag cttccacagcaatggcatcctggtcatccag cggatagttaatgatcagcccactgacgcgt tgcgcgagaagattgtgcaccgccgctttac aggcttcgacgccgcttcgttctaccatcga caccaccacgctggcacccagttgatcggcg cgagatttaatcgccgcgacaatttgcgacg gcgcgtgcagggccagactggaggtggcaac gccaatcagcaacgactgtttgcccgccagt tgttgtgccacgcggttgggaatgtaattca gctccgccatcgccgcttccactttttcccg cgttttcgcagaaacgtggctggcctggttc accacgcgggaaacggtctgataagagacac cggcatactctgcgacatcgtataacgttac tggtttcacattcaccaccctgaattgactc tcttccgggcgctatcatgccataccgcgaa aggttttgcgccattcgatggtgtccgggat ctcgacgctctcccttatgcgactcctgcat taggaagcagcccagtagtaggttgaggccg ttgagcaccgccgccgcaaggaatggtgcat gcaaggagatggcgcccaacagtcccccggc cacggggcctgccaccatacccacgccgaaa caagcgctcatgagcccgaagtggcgagccc gatcttccccatcggtgatgtcggcgatata ggcgccagcaaccgcacctgtggcgccggtg atgccggccacgatgcgtccggcgtagagga tcgagatctcgatcccgcgaaattaatacga ctcactataggggaattgtgagcggataaca attcccctctagaaataattttgtttaactt taagaaggagatataccATGGCCGA GGACGCAGACATGCGCAATG AGCTGGAGGAGATGCAGAGG AGGGCTGACCAGCTGGCTGA TGAGTCCCTGGAAAGCACCC GTCGCATGCTGCAGCTGGTT GAAGAGAGTAAAGATGCTGG CATCAGGACTTTGGTTATGTT GGATGAGCAAGGCGAACAAC TGGAACGCATTGAGGAAGGG ATGGACCAAATCAATAAGGAC ATGAAAGAAGCAGAAAAGAAT TTGACGGACCTAGGAAAATTC GCCGGCCTTGCCGTGGCCCC CGCCAACAAGCTTAAATCCAG TGATGCTTACAAAAAAGCCTG GGGCAATAATCAGGATGGAGT AGTGGCCAGCCAGCCTGCCC GTGTGGTGGATGAACGGGAG CAGATGGCCATCAGTGGTGGC TTCATCCGCAGGGTAACAAAT GATGCCCGGGAAAATGAGATG GATGAGAACCTGGAGCAGGT GAGCGGCATCATCGGAAACCT CCGCCACATGGCTCTAGACAT GGGCAATGAGATTGACACCCA GAATCGCCAGATCGACAGGAT CATGGAGAAGGCTGATTCCAA CAAAACCAGAATTGATGAAGC CAACCAACGTGCAACAAAGAT GCTGGGAAGTGGTTAA ctcgagcaccaccaccaccaccactgag atccggctgctaacaaagcccgaaagga agctgagttggctgctgccaccgctgagc aataactagcataaccccttggggcctc taaacgggtcttgaggggttttttgctgaa aggaggaactatatccggat |
|
| Materials for protein purificaiton | |||
| 2-Mercaptoethanol | SIGMA | M3148-25ML | |
| Agar | LPS Solution | AGA500 | |
| Ampicillin, Sodium salt | PLS | AC1043-005-00 | |
| Chloramphenicol | PLS | CR1023-050-00 | |
| Competent cells (E. coli) | Novagen | 70956 | Rosetta(DE3)pLysS |
| Glycerol | SIGMA | G5516-500ML | |
| HEPES | SIGMA | H4034-100G | |
| Hydrochloric acid / HCl | SIGMA | 320331-500ML | |
| Imidazole | SIGMA | I2399-100G | |
| Isopropyl β-D-1-thiogalactopyranoside / IPTG | SIGMA | 10724815001 | |
| Kanamycin Sulfate | PLS | KC1001-005-02 | |
| Luria-Bertani (LB) Broth | LPS Solution | LB-05 | |
| Ni-NTA resin | Qiagen | 30210 | |
| PD MiniTrap G-25 (desalting column) | Cytiva | GE28-9180-07 | For instructions, see: https://www.cytivalifesciences.com/en/us/shop/chromatography/prepacked-columns/desalting-and-buffer-exchange/pd-minitrap-desalting-columns-with-sephadex-g-25-resin-p-06174 |
| Phenylmethylsulfonyl fluoride / PMSF | ThermoFisher Scientific | 36978 | |
| Plasmids for SNARE proteins | cloned in house | N/A | Available upon request |
| Protease inhibitor cocktail | genDEPOT | P3100 | |
| Sodium chloride | SIGMA | S5886-500G | |
| Sodium phosphate dibasic / Na2HPO4 | SIGMA | S7907-100G | |
| Sodium phosphate monobasic / NaH2PO4 | SIGMA | S3139-250G | |
| Tris(2-carboxyethyl)phosphine / TCEP | SIGMA | C4706-2G | |
| Trizma base | SIGMA | T1503-250G | |
| Materials for sample assembly | |||
| Biotin-PEG-SVA | LAYSAN BIO | BIO-PEG-SVA-5K-100MG & MPEG-SVA-5K-1g | For PEGylation |
| Dibenzocyclooctyne-amine / DBCO-NH2 | SIGMA | 761540-10MG | For bead coating |
| Double-sided tape | 3M | 136 | For flow cell assembly |
| Epoxy glue | DEVCON | S-208 | For flow cell assembly |
| Glass coverslip for bottom surface | VWR | 48393-251 | Rectangular, 60×24 mm, #1.5 |
| Glass coverslip for top surface | VWR | 48393-241 | Rectangular, 50×24 mm, #1.5 |
| Magnetic bead | ThermoFisher Scientific | 14301 | Dynabeads M-270 Epoxy, 2.8 μm |
| mPEG-SVA | LAYSAN BIO | mPEG-SVA 1g | For PEGylation |
| N,N-Dimethylformamide / DMF | SIGMA | D4551-250ML | For bead coating |
| N-[3-(trimethoxysilyl)propyl]ethylenediamine | SIGMA | 104884-100ML | For PEGylation |
| Neutravidin | ThermoFisher Scientific | 31000 | For sample tethering |
| Phosphate buffered saline / PBS, pH 7.2 | PLS | PR2007-100-00 | |
| Plastic syringe | Norm-ject | A5 | 5 ml, luer tip |
| Polyethylene Tubing | SCI | BB31695-PE/4 | PE-60 |
| Reference bead | SPHEROTECH | SVP-30-5 | Streptavidin-coated Polystyrene Particles; 3.0-3.4 µm |
| Syringe needle | Kovax | 21G-1 1/4'' | 21 G |
| Syringe pump | KD SCIENTIFIC | 788210 | |
| Equipment for magnetic tweezer instrument | |||
| 1-axis motorized microtranslation stage | PI | M-126.PD1 | For vertical positioning of magnets |
| 2-axis manual translation stage | ST1 | LEE400 | For alignment of magnets to the optical axis |
| Acrylic holder for magnets | DaiKwang Precision | custum order | Drawing available upon request |
| Frame grabber | Active Silicon | AS-FBD-4XCXP6-2PE8 | |
| High-speed CMOS camera | Mikrotron | EoSens 3CXP | |
| Inverted microscope | Olympus | IX73P2F-1-2 | |
| Neodymium magnets | LG magnet | ND 10x10x12t | Dimension: 10 mm × 10 mm × 12 mm; two needed |
| Objective lens | Olympus | UPLXAPO100XO | Oil-immersion, NA 1.45 |
| Objective lens nanopositioner | Mad City Labs | Nano-F100S | |
| Rotation stepper motor | AUTONICS | A3K-S545W | For rotating magnets |
| Superluminescent diode | QPHOTONICS | QSDM-680-2 | 680 nm |
| Software | |||
| LabVIEW | National Instruments | v20.0f1 | |
| MATLAB | MathWorks | v2021a |
Referencias
- Le, S., Liu, R., Lim, C. T., Yan, J. Uncovering mechanosensing mechanisms at the single protein level using magnetic tweezers. Methods. 94, 13-18 (2016).
- Choi, H. -. K., Kim, H. G., Shon, M. J., Yoon, T. -. Y. High-resolution single-molecule magnetic tweezers. Annual Review of Biochemistry. 91 (1), 33-59 (2022).
- Yang, T., Park, C., Rah, S. -. H., Shon, M. J. Nano-precision tweezers for mechanosensitive proteins and beyond. Molecules and Cells. 45 (1), 16-25 (2022).
- Neuman, K. C., Nagy, A. Single-molecule force spectroscopy: optical tweezers, magnetic tweezers and atomic force microscopy. Nature Methods. 5 (6), 491-505 (2008).
- De Vlaminck, I., Dekker, C. Recent advances in magnetic tweezers. Annual Review of Biophysics. 41 (1), 453-472 (2012).
- Bustamante, C. J., Chemla, Y. R., Liu, S., Wang, M. D. Optical tweezers in single-molecule biophysics. Nature Reviews Methods Primers. 1, 25 (2021).
- Gosse, C., Croquette, V. Magnetic tweezers: micromanipulation and force measurement at the molecular level. Biophysical Journal. 82 (6), 3314-3329 (2002).
- Smith, S. B., Finzi, L., Bustamante, C. Direct mechanical measurements of the elasticity of single DNA molecules by using magnetic beads. Science. 258 (5085), 1122-1126 (1992).
- Lansdorp, B. M., Tabrizi, S. J., Dittmore, A., Saleh, O. A. A high-speed magnetic tweezer beyond 10,000 frames per second. Review of Scientific Instruments. 84 (4), 044301 (2013).
- Cnossen, J. P., Dulin, D., Dekker, N. H. An optimized software framework for real-time, high-throughput tracking of spherical beads. Review of Scientific Instruments. 85 (10), 103712 (2014).
- Dulin, D., et al. High spatiotemporal-resolution magnetic tweezers: calibration and applications for DNA dynamics. Biophysical Journal. 109 (10), 2113-2125 (2015).
- Huhle, A., et al. Camera-based three-dimensional real-time particle tracking at kHz rates and Ångström accuracy. Nature Communications. 6 (1), 5885 (2015).
- Popa, I., et al. A HaloTag anchored ruler for week-long studies of protein dynamics. Journal of the American Chemical Society. 138 (33), 10546-10553 (2016).
- Shon, M. J., Kim, H., Yoon, T. -. Y. Focused clamping of a single neuronal SNARE complex by complexin under high mechanical tension. Nature Communications. 9 (1), 3639 (2018).
- Tapia-Rojo, R., Eckels, E. C., Fernández, J. M. Ephemeral states in protein folding under force captured with a magnetic tweezers design. Proceedings of the National Academy of Sciences. 116 (16), 7873-7878 (2019).
- Löf, A., et al. Multiplexed protein force spectroscopy reveals equilibrium protein folding dynamics and the low-force response of von Willebrand factor. Proceedings of the National Academy of Sciences. 116 (38), 18798-18807 (2019).
- Tapia-Rojo, R., Alonso-Caballero, A., Fernandez, J. M. Direct observation of a coil-to-helix contraction triggered by vinculin binding to talin. Science Advances. 6 (21), (2020).
- Rieu, M., et al. Parallel, linear, and subnanometric 3D tracking of microparticles with Stereo Darkfield Interferometry. Science Advances. 7 (6), (2021).
- Rieu, M., Valle-Orero, J., Ducos, B., Allemand, J. -. F., Croquette, V. Single-molecule kinetic locking allows fluorescence-free quantification of protein/nucleic-acid binding. Communications Biology. 4 (1), 1083 (2021).
- Woodside, M. T., et al. Nanomechanical measurements of the sequence-dependent folding landscapes of single nucleic acid hairpins. Proceedings of the National Academy of Sciences. 103 (16), 6190-6195 (2006).
- Camunas-Soler, J., Ribezzi-Crivellari, M., Ritort, F. Elastic properties of nucleic acids by single-molecule force spectroscopy. Annual Review of Biophysics. 45 (1), 65-84 (2016).
- Südhof, T. C., Rothman, J. E. Membrane fusion: grappling with SNARE and SM proteins. Science. 323 (5913), 474-477 (2009).
- Gao, Y., et al. Single reconstituted neuronal SNARE complexes zipper in three distinct stages. Science. 337 (6100), 1340-1343 (2012).
- Zorman, S., et al. Common intermediates and kinetics, but different energetics, in the assembly of SNARE proteins. eLife. 3, e03348 (2014).
- Zhang, Y., Hughson, F. M. Chaperoning SNARE folding and assembly. Annual Review of Biochemistry. 90 (1), 581-603 (2021).
- Vilfan, I. D., Lipfert, J., Koster, D. A., Lemay, S. G., Dekker, N. H. Magnetic tweezers for single-molecule experiments. Handbook of Single-Molecule Biophysics. , 371-395 (2009).
- You, H., Le, S., Chen, H., Qin, L., Yan, J. Single-molecule manipulation of G-quadruplexes by magnetic tweezers. Journal of Visualized Experiments. (127), e56328 (2017).
- Lipfert, J., Hao, X., Dekker, N. H. Quantitative modeling and optimization of magnetic tweezers. Biophysical Journal. 96 (12), 5040-5049 (2009).
- Dulin, D., Barland, S., Hachair, X., Pedaci, F. Efficient illumination for microsecond tracking microscopy. PLoS One. 9 (9), e107335 (2014).
- Klaue, D., Seidel, R. Torsional stiffness of single superparamagnetic microspheres in an external magnetic field. Physical Review Letters. 102 (2), 028302 (2009).
- Shon, M. J., Rah, S. -. H., Yoon, T. -. Y. Submicrometer elasticity of double-stranded DNA revealed by precision force-extension measurements with magnetic tweezers. Science Advances. 5 (6), 1697 (2019).
- Czerwinski, F., Richardson, A. C., Oddershede, L. B. Quantifying noise in optical tweezers by Allan variance. Optics Express. 17 (15), 13255-13269 (2009).
- Lansdorp, B. M., Saleh, O. A. Power spectrum and Allan variance methods for calibrating single-molecule video-tracking instruments. Review of Scientific Instruments. 83 (2), 025115 (2012).
- Ostrofet, E., Papini, F. S., Dulin, D. High spatiotemporal resolution data from a custom magnetic tweezers instrument. Data in Brief. 30, 105397 (2020).
- Yu, Z., et al. A force calibration standard for magnetic tweezers. Review of Scientific Instruments. 85 (12), 123114 (2014).
- Strick, T. R., Allemand, J. -. F., Bensimon, D., Bensimon, A., Croquette, V. The elasticity of a single supercoiled DNA molecule. Science. 271 (5257), 1835-1837 (1996).
- Daldrop, P., Brutzer, H., Huhle, A., Kauert, D. J., Seidel, R. Extending the range for force calibration in magnetic tweezers. Biophysical Journal. 108 (10), 2550-2561 (2015).
- te Velthuis, A. J. W., Kerssemakers, J. W. J., Lipfert, J., Dekker, N. H. Quantitative guidelines for force calibration through spectral analysis of magnetic tweezers data. Biophysical Journal. 99 (4), 1292-1302 (2010).
- Ostrofet, E., Papini, F. S., Dulin, D. Correction-free force calibration for magnetic tweezers experiments. Scientific Reports. 8 (1), 15920 (2018).
- Seol, Y., Li, J., Nelson, P. C., Perkins, T. T., Betterton, M. D. Elasticity of short DNA molecules: theory and experiment for contour lengths of 0.6-7 µm. Biophysical Journal. 93 (12), 4360-4373 (2007).
- Burnham, D. R., Vlaminck, I. D., Henighan, T., Dekker, C. Skewed Brownian fluctuations in single-molecule magnetic tweezers. PLoS One. 9 (9), 108271 (2014).
- Paul, T., Myong, S. Protocol for generation and regeneration of PEG-passivated slides for single-molecule measurements. STAR Protocols. 3 (1), 101152 (2022).
- Lee, H. -. W., et al. Profiling of protein-protein interactions via single-molecule techniques predicts the dependence of cancers on growth-factor receptors. Nature Biomedical Engineering. 2 (4), 239-253 (2018).
- Cheezum, M. K., Walker, W. F., Guilford, W. H. Quantitative comparison of algorithms for tracking single fluorescent particles. Biophysical Journal. 81 (4), 2378-2388 (2001).
- Parthasarathy, R. Rapid, accurate particle tracking by calculation of radial symmetry centers. Nature Methods. 9 (7), 724-726 (2012).
- Woodside, M. T., Block, S. M. Reconstructing folding energy landscapes by single-molecule force spectroscopy. Annual Review of Biophysics. 43 (1), 19-39 (2014).
- Evans, E., Ritchie, K. Dynamic strength of molecular adhesion bonds. Biophysical Journal. 72 (4), 1541-1555 (1997).
- Zhang, Y. Energetics, kinetics, and pathway of SNARE folding and assembly revealed by optical tweezers. Protein Science. 26 (7), 1252-1265 (2017).
- Chen, H., et al. Improved high-force magnetic tweezers for stretching and refolding of proteins and short DNA. Biophysical Journal. 100 (2), 517-523 (2011).
- Cho, S., et al. Tension exerted on cells by magnetic nanoparticles regulates differentiation of human mesenchymal stem cells. Biomaterials Advances. 139, 213028 (2022).
- Shon, M. J., Cohen, A. E. Nano-mechanical measurements of protein-DNA interactions with a silicon nitride pulley. Nucleic Acids Research. 44 (1), 7 (2016).
- Cheng, Y. Single-particle cryo-EM-How did it get here and where will it go. Science. 361 (6405), 876-880 (2018).
- Jumper, J., et al. Highly accurate protein structure prediction with AlphaFold. Nature. 596 (7873), 583-589 (2021).
- Neupane, K., et al. Direct observation of transition paths during the folding of proteins and nucleic acids. Science. 352 (6282), 239-242 (2016).
- Choi, H. -. K., et al. Watching helical membrane proteins fold reveals a common N-to-C-terminal folding pathway. Science. 366 (6469), 1150-1156 (2019).
- Kim, C., et al. Extreme parsimony in ATP consumption by 20S complexes in the global disassembly of single SNARE complexes. Nature Communications. 12 (1), 3206 (2021).
Tags
Magnetic TweezersNanomechanical MeasurementsForce-sensitive ElementsBiomoleculesStructural ChangesNucleic AcidsProteinsMechanosensitive ProteinsCardiovascular DisordersMusculoskeletal DisordersHigh-speed CMOS CameraMotorized Linear StageRotary Stepper MotorSuper Luminescent DiodePiezo Lens ScannerCoverslip PreparationPegylation
Citar este artículo
Park, C., Yang, T., Rah, S., Kim, H. G., Yoon, T., Shon, M. J. High-Speed Magnetic Tweezers for Nanomechanical Measurements on Force-Sensitive Elements. J. Vis. Exp. (195), e65137, doi:10.3791/65137 (2023).