בסיס מבוסס על תגובת שרשרת פולימראז חזקה עבור כימות ציטוסינוס-גואנין-גואנין Trinucleotide גאות חוזר בצורה שברירית X פיגור-1 גן
Summary
מדויק וחזק מבוסס תגובת שרשרת פולימראז ‘ המבוססת על ככמת ציטוסינוס-גואן ין-גואנין trinucleotide גאות חוזר על הפיגור שברירי X 1 גן מקלה אבחנה מולקולרית והקרנה של תסמונת X שביר והקשורות X שברירי הפרעות עם הזמן להסתובב קצר והשקעה בציוד.
Abstract
תסמונת X שביר (FXS) והפרעות הקשורות נגרמות על ידי התרחבות של ציטוסין-גואן-גואן-גואנין (CGG) טריטוקלאואדה חוזר באזור 5 ‘ בלתי מתורגם (UTR) של פיגור שברירי X 1 (FMR1) גן יזם. מקובל, ניתוח מקטע של אלקטרופורזה קפילר על מנתח גנטי משמש לשינוי גודל CGG חוזר של FMR1, אך ניתוח כתמי דרומי נוסף נדרש למדידה מדויקת כאשר מספר החזרה גבוה מ-200. כאן, אנו מציגים שיטה מדויקת ואיתנה של תגובת שרשרת פולימראז (PCR) לקוונפיקציה של ה-CGG חוזר על FMR1. השלב הראשון של בדיקה זו הוא ה-PCR הגברה של רצפי חוזר ב 5 ‘ UTR של FMR1 יזם באמצעות ערכת ה-pcr X שביר, ואחריו טיהור של מוצרי ה-PCR ושינוי גודל על מכשיר אלקטרופורזה מיקרופלואידיסי נימי, ו פרשנות הבאה של מספר ה-CGG חוזר על-ידי התייחסות לתקנים עם הידוע חוזר באמצעות תוכנת הניתוח. שיטת ה-PCR מבוססת ומסוגלת לזהות את הטווח המלא של CGG חוזר על FMR1 יזמים, כולל אלה עם מספר חוזר של יותר מ 200 (מסווג כמוטציה מלאה), 55 כדי 200 (premutation), 46 ל54 (ביניים), ו 10 כדי 45 (רגיל). זוהי שיטה חסכונית המאפשרת סיווג של FXS ו-X שברירי הפרעות הקשורות עם החוסן וזמן דיווח מהיר.
Introduction
תסמונת X שביר (FXS) ושברירי X הפרעות הקשורות, למשל, רעד תסמונת אטקסיה (FX-TAS), ואת אי ספיקה השחלות הראשונית (FX-פוי) נגרמים בעיקר על ידי ציטוסין-גואן-ין (CGG) טריאוקליאואס חוזר על התרחבות 5 ‘ לא תורגם אזור (UTR) של הפיגור שברירי X-1 (FMR1) גן על xq 27.31,2. חלבון FMR1 מקודד (FMRP) הוא חלבון רב-תפקודי מסוג RNA-binding המשויכים להתפתחות העצבית והפלסטיות הסינפטית על-ידי ויסות שילוב אלטרנטיבי, יציבות, והובלת הדנדריטים של mrna או סינתזה של מודליטינג של חלבונים חלקיים מתוך הסינפטית3,4,5,6,7.
הווריאציה הדינמית עם גודל החזרה CGG של > 200 מתוארת כמוטציה מלאה, אשר מעוררת את ההיפרלציה החריגה ובעקבות השתקה של FMR1 יזם8. העדר או חוסר של חלבון FMRP משבש את פיתוח עצבי נורמלי גורם FXS9, מאופיין בסימפטומים קליניים שונים, כולל מתון עד מוגבלות אינטלקטואלית חמורה, עיכוב התפתחותי, התנהגויות היפראקטיביות, קשרים עניים וביטויים אוטיסטים10,11,12. המצגת אצל הנקבה FXS לחולי הוא בדרך כלל מתון יותר מזה אצל זכרים. גודל החזרה CGG החל מ 55 אל 200 ו 45 כדי 54 מסווגים כסטטוס מוטציה וביניים, בהתאמה. בשל הרמה הגבוהה של חוסר יציבות, גודל החזרה cgg ב מוטציה או ביניים אלל ככל הנראה מתרחב כאשר מועברים מהורים לצאצאים13,14. לפיכך, נושאות עם אללים מוטציות בסיכון גבוה של הילדים מושפעים FXS בגלל התרחבות חוזר, ובמקרים מסוימים, אללים ביניים יכול להרחיב את גודל החזרה שלהם לטווח מוטציה מלא על פני שני דורות15, . שישה עשרה יתר על כן, זכרים עם premutation גם להעביר סיכון מוגבר לפתח מאוחר התפרצות FX-TAS17,18,19, בעוד נקבות premutation וטציה הם מראש עבור שני fx-TAS ו-fx-פוי20, 21,22. לאחרונה, דווח כי הפרעות הספקטרום האוטיסטי עם עיכוב התפתחותי ובעיות בהתנהגויות חברתיות מוצגות אצל ילדים עם premutation אללים 23,24.
כדי לקבוע את גודל החזרה cgg מדויק הוא של משמעות רבה עבור סיווג וחיזוי של FXS ו-X שברירי הפרעות הקשורות25,26. מבחינה היסטורית, התגובה הספציפית של CGG שרשרת פולימראז (PCR) עם שינוי גודל בתוספת ניתוח הכתם הדרומי היה תקן זהב עבור פרופיל מולקולרי של FMR1 cgg חוזר27. עם זאת, ה-PCR הספציפי המסורתי הוא פחות רגיש למוטציות גדולות עם יותר מ 100 כדי 130 חוזר ואינו מסוגל להגברה מוטציות מלאות27,28. יתר על כן, אלקטרופורזה קפילר על מנתח גנטי מסורתי לשינוי גודל נכשל לזהות FMR1 PCR מוצרים עם יותר מ-200 cgg חוזר. ניתוח הכתם הדרומי מאפשר הבידול של מגוון רחב יותר של גודל חוזר, מהרגיל למספרים חוזרים מוטציה מלאה, והיה בשימוש נרחב לאישור מוטציות מלאות (אצל גברים) וההבחנה heterozygous אללים עם מוטציה מלאה מ כנראה homozygous אללים עם גדלי חזרה נורמליים (אצל נקבות). עם זאת, הרזולוציה עבור כימות החזרה מוגבלת. חשוב מכך, אסטרטגיית הבדיקה של שלב אחר שלב היא אינטנסיבית לעבודה, גוזלת זמן וחסכונית.
כאן, אנו מציגים שיטה מדויקת ואיתנה המבוססת על PCR לכמת של CGG חוזר על FMR1. השלב הראשון של מבחן זה הוא הגברה PCR של רצפי חוזר ב 5 ‘ UTR של יזם FMR1 באמצעות ערכת X PCR שביר. מוצרי ה-PCR מטוהרים ושינוי גודל מבוצע על-ידי מכשיר אלקטרופורזה במיקרופלואידיסי, והפרשנות העוקבת של מספר cgg חוזרת באמצעות תוכנת הניתוח על-ידי התייחסות לתקנים הידועים ומבוססים על ה רציונל כי אורך קטע ה-PCR פרופורציונלי באופן ישיר למספר החזרה של CGG. מערכת ה-PCR כוללת ריאגנטים המקל על הגברה של האזור הגדול ביותר במערכת האנטי-GC העשיר. שיטת ה-PCR מבוססת ומסוגלת לזהות את כל הטווחים של CGG חוזר על FMR1 יזמים. זוהי שיטה חסכונית שיכולה למצוא יישום רחב באבחנה מולקולרית והקרנת של FXS ו-X שברירי הפרעות הקשורות עם פחות סיבוב הזמן וההשקעה בציוד ולכן, יכול להיות מנוצל בספקטרום רחב של קליני מעבדות.
Protocol
Representative Results
Discussion
FXS הוא הגורם השכיח ביותר השני של ליקוי אינטלקטואלי לאחר טריזומיה 21, חשבונאות עבור כמעט אחד מחצית של פיגור שכלי מנטלי של X30, אשר עשוי להשפיע על כ 1 ב 4,000 זכרים 1 ב 8,000 נקבות. חשוב יותר, כמעט 1 ב 250 – 1000 הנקבות לשאת premutation, ואת התדר הזה הוא 1 ב 250 – 1600 בזכרים26,31…
Divulgaciones
The authors have nothing to disclose.
Acknowledgements
מחקר זה נתמך על ידי מענקים NSFC ניהול חירום הפרויקט (גרנט No. 81741004), הארגון הלאומי למדע הטבע של סין (גרנט No. 81860272), תוכנית המחקר העיקרי של המדע המחוזי הקרן טכנולוגיה של גואנגשי ( . גרנט לא AB16380219), בקרן המדע הפוסט-דוקטורט של סין (גרנט No. 2018M630993), והקרן למדע הטבע גואנגשי (מענק No. 2018GXNSFAA281067).
Materials
| Agilent 2100 Bioanalyzer instrument: 0.2 mL PCR tubes | Axygen | PCR-02D-C | |
| Agilent 2100 Bioanalyzer instrument: 1X TE buffer, pH 8.0, Rnase-free | Ambion | AM9849 | |
| Agilent 2100 Bioanalyzer instrument: 2100 Bioanalyzer instrument | Agilent | G2939AA | |
| Agilent 2100 Bioanalyzer instrument: 96-well PCR Plate | Thermo Fisher | AB0800 | |
| Agilent 2100 Bioanalyzer instrument: Electrode cartridge | Agilent | Supplies equipment of the 2100 Bioanayzer instrument | |
| Agilent 2100 Bioanalyzer instrument: IKA vortex mixer | Agilent | Supplies equipment of the 2100 Bioanayzer instrument | |
| Agilent 2100 Bioanalyzer instrument: Sizing software 2100 Expert software | Agilent | Supplies equipment of the 2100 Bioanayzer instrument | |
| Agilent 2100 Bioanalyzer instrument: Test chips | Agilent | Supplies equipment of the 2100 Bioanayzer instrument | |
| Agilent DNA 7500 kit | Agilent | 5067-1506 | For Fragment sizing |
| Agilent DNA 7500 kit: DNA 7500 Ladder (yellow cap) | Agilent | In kit: Agilent DNA 7500 kit (catalog number: 5067-1506) | |
| Agilent DNA 7500 kit: DNA 7500 Markers (green cap) | Agilent | In kit: Agilent DNA 7500 kit (catalog number: 5067-1506) | |
| Agilent DNA 7500 kit: DNA chips | Agilent | In kit: Agilent DNA 7500 kit (catalog number: 5067-1506) | |
| Agilent DNA 7500 kit: DNA Dye Concentrate (blue cap) | Agilent | In kit: Agilent DNA 7500 kit (catalog number: 5067-1506) | |
| Agilent DNA 7500 kit: DNA Gel Matrix Vial (red cap) | Agilent | In kit: Agilent DNA 7500 kit (catalog number: 5067-1506) | |
| Agilent DNA 7500 kit: Electrode Cleaner | Agilent | In kit: Agilent DNA 7500 kit (catalog number: 5067-1506) | |
| Agilent DNA 7500 kit: Spin Filter | Agilent | Supplies of Agilent DNA 7500 kit (catalog number: 5067-1506) | |
| Agilent DNA 7500 kit: Syringe | Agilent | Supplies of Agilent DNA 7500 kit (catalog number: 5067-1506) | |
| Chip priming station | Agilent | 5065-4401 | Supplies equipment of the 2100 Bioanayzer instrument |
| Cubee Mini-centrifuge | GeneReach | aqbd-i | |
| Filter plate vacuum Manifold: MultiScreenHTS Vacuum Manifold | Merck Millipore | MSVMHTS00 | Vacuum instrument for Filter plate vacuum Manifold for PCR product purification |
| Filter plate vacuum Manifold: Silicone stopper | Merck Millipore | XX2004718 | Filter plate vacuum Manifold |
| Filter plate vacuum Manifold: Vacuum pump | Merck Millipore | WP6122050 | Filter plate vacuum Manifold |
| Filter plate vacuum Manifold: Waste collection vessel | Merck Millipore | XX1004705 | Filter plate vacuum Manifold |
| FragilEase Fragile X PCR kit | PerkinElmer | 3101-0010 | For PCR amplification |
| FragilEase Fragile X PCR kit: Sample Diluent | PerkinElmer | In kit: FragilEase Fragile X PCR kit (catalog number: 3101-0010 ) | |
| FragilEase PCR Buffer mix | PerkinElmer | In kit: FragilEase Fragile X PCR kit (catalog number: 3101-0010 ), containing primers. Primer sequences: TCAGGCGCTCAGCTCCGTTTCGGTTTCA (forward) FAM-AAGCGCCATTGGAGCCCCGCACTTCC (reverse) |
|
| FragilEase Polymerase | PerkinElmer | In kit: FragilEase Fragile X PCR kit (catalog number: 3101-0010 ) | |
| FraXsoft analysis software | PerkinElmer | ||
| NanoDrop ND-2000 Spectrophotometer | Thermo Fisher | ||
| Paper towels | |||
| PCR clean up plate: NucleoFast 96 PCR plate | MACHEREY-NAGEL | 743100 | |
| reference DNA sample | Coriell | NA20240 & NA20239 | |
| S1000 96-well Thermal Cycler | Bio-Rad | 1852196 | This can be replaced by other Thermal Cyclers (eg. Veriti™ 96-Well Thermal Cycler, Applied Biosystems, catalog number: 4375786) |
| TriNEST Incubator/Shaker instrument | PerkinElmer | 1296-0050 | |
| UltraPure DNase/RNase-Free Distilled Water | Life Technologies | 10977015 | For 2100 Bioanalyzer electrode cleaning |
| Vortex-Genie 2 | Scientific Industries | SI-0256 (Model G560E) | Conventional vortex mixer |
Referencias
- Verkerk, A. J., et al. Identification of a gene (FMR-1) containing a CGG repeat coincident with a breakpoint cluster region exhibiting length variation in fragile X syndrome. Cell. 65, 905-914 (1991).
- Fu, Y. H., et al. Variation of the CGG repeat at the fragile X site results in genetic instability: resolution of the Sherman paradox. Cell. 67, 1047-1058 (1991).
- Antar, L. N., Li, C., Zhang, H., Carroll, R. C., Bassell, G. J. Local functions for FMRP in axon growth cone motility and activity-dependent regulation of filopodia and spine synapses. Molecular and Cellular Neurosciences. 32, 37-48 (2006).
- Didiot, M. C., et al. The G-quartet containing FMRP binding site in FMR1 mRNA is a potent exonic splicing enhancer. Nucleic Acids Research. 36, 4902-4912 (2008).
- Bechara, E. G., et al. A novel function for fragile X mental retardation protein in translational activation. PLoS Biology. 7, e16 (2009).
- Ascano, M., et al. FMRP targets distinct mRNA sequence elements to regulate protein expression. Nature. 492, 382-386 (2012).
- Kenny, P. J., et al. MOV10 and FMRP regulate AGO2 association with microRNA recognition elements. Cell Reports. 9, 1729-1741 (2014).
- Oberle, I., et al. Instability of a 550-base pair DNA segment and abnormal methylation in fragile X syndrome. Science. 252, 1097-1102 (1991).
- Hagerman, R., Lauterborn, J., Au, J., Berry-Kravis, E. Fragile X syndrome and targeted treatment trials. Results and Problems in Cell Differentiation. 54, 297-335 (2012).
- Hatton, D. D., et al. Autistic behavior in children with fragile X syndrome: prevalence, stability, and the impact of FMRP. American Journal of Medical Genetics Part A. 140A, 1804-1813 (2006).
- Mattei, J. F., Mattei, M. G., Aumeras, C., Auger, M., Giraud, F. X-linked mental retardation with the fragile X. A study of 15 families. Human Genetics. 59, 281-289 (1981).
- Backes, M., et al. Cognitive and behavioral profile of fragile X boys: correlations to molecular data. American Journal of Medical Genetics. 95, 150-156 (2000).
- Nolin, S. L., et al. Fragile X analysis of 1112 prenatal samples from 1991 to 2010. Prenatal Diagnosis. 31, 925-931 (2011).
- Nolin, S. L., et al. Expansion of the fragile X CGG repeat in females with premutation or intermediate alleles. American Journal of Human Genetics. 72, 454-464 (2003).
- Fernandez-Carvajal, I., et al. Expansion of an FMR1 grey-zone allele to a full mutation in two generations. Journal of Molecular Diagnostics. 11, 306-310 (2009).
- Terracciano, A., et al. Expansion to full mutation of a FMR1 intermediate allele over two generations. European Journal of Human Genetics. 12, 333-336 (2004).
- Garcia-Arocena, D., Hagerman, P. J. Advances in understanding the molecular basis of FXTAS. Human Molecular Genetics. 19, R83-R89 (2010).
- Juncos, J. L., et al. New clinical findings in the fragile X-associated tremor ataxia syndrome (FXTAS). Neurogenetics. 12, 123-135 (2011).
- Hagerman, R. J., et al. Intention tremor, parkinsonism, and generalized brain atrophy in male carriers of fragile X. Neurology. 57, 127-130 (2001).
- Conway, G. S. Premature ovarian failure and FMR1 gene mutations: an update. Annales d’endocrinologie. 71, 215-217 (2010).
- Conway, G. S., Hettiarachchi, S., Murray, A., Jacobs, P. A. Fragile X premutations in familial premature ovarian failure. Lancet. 346, 309-310 (1995).
- Van Esch, H., Buekenhout, L., Race, V., Matthijs, G. Very early premature ovarian failure in two sisters compound heterozygous for the FMR1 premutation. European Journal of Medical Genetics. 52, 37-40 (2009).
- Bourgeois, J. A., et al. A review of fragile X premutation disorders: expanding the psychiatric perspective. Journal of Clinical Psychiatry. 70, 852-862 (2009).
- Farzin, F., et al. Autism spectrum disorders and attention-deficit/hyperactivity disorder in boys with the fragile X premutation. Journal of Developmental and Behavioral Pediatrics. 27, S137-S144 (2006).
- Hantash, F. M., et al. FMR1 premutation carrier frequency in patients undergoing routine population-based carrier screening: insights into the prevalence of fragile X syndrome, fragile X-associated tremor/ataxia syndrome, and fragile X-associated primary ovarian insufficiency in the United States. Genetics in Medicine. 13, 39-45 (2011).
- Kraan, C. M., et al. FMR1 allele size distribution in 35,000 males and females: a comparison of developmental delay and general population cohorts. Genetics in Medicine. 20 (12), 1627-1634 (2018).
- Saul, R. A., Tarleton, J. C. FMR1-Related Disorders. GeneReviews. , (2012).
- Amos Wilson, J., et al. Consensus characterization of 16 FMR1 reference materials: a consortium study. Journal of Molecular Diagnostics. 10, 2-12 (2008).
- Kwok, Y. K., et al. Validation of a robust PCR-based assay for quantifying fragile X CGG repeats. Clinica Chimica Acta. 456, 137-143 (2016).
- Rousseau, F., Rouillard, P., Morel, M. L., Khandjian, E. W., Morgan, K. Prevalence of carriers of premutation-size alleles of the FMRI gene–and implications for the population genetics of the fragile X syndrome. American Journal of Human Genetics. 57, 1006-1018 (1995).
- Tassone, F., et al. FMR1 CGG allele size and prevalence ascertained through newborn screening in the United States. Genome Medicine. 4, 100 (2012).
- Dombrowski, C., et al. Premutation and intermediate-size FMR1 alleles in 10572 males from the general population: loss of an AGG interruption is a late event in the generation of fragile X syndrome alleles. Human Molecular Genetics. 11, 371-378 (2002).
- Cronister, A., Teicher, J., Rohlfs, E. M., Donnenfeld, A., Hallam, S. Prevalence and instability of fragile X alleles: implications for offering fragile X prenatal diagnosis. Obstetrics and Gynecology. 111, 596-601 (2008).
- Hayward, B. E., Kumari, D., Usdin, K. Recent advances in assays for the fragile X-related disorders. Human Genetics. 136, 1313-1327 (2017).
- Seltzer, M. M., et al. Prevalence of CGG expansions of the FMR1 gene in a US population-based sample. American Journal of Medical Genetics Part B Neuropsychiatrics Genetics. 259B, 589-597 (2012).
- Hayward, B. E., Usdin, K. Assays for determining repeat number, methylation status, and AGG interruptions in the Fragile X-related disorders. Methods in Molecular Biology. , 49-59 (1942).
- Orrico, A., et al. Mosaicism for full mutation and normal-sized allele of the FMR1 gene: a new case. American Journal of Medical Genetics. 78, 341-344 (1998).
- Schmucker, B., Seidel, J. Mosaicism for a full mutation and a normal size allele in two fragile X males. American Journal of Medical Genetics. 84, 221-225 (1999).
