Using DNA-Based Tension Probes to Assess Receptor Forces Applied by Immune Cells
Published: February 29, 2024
Abstract
Source: Ma, R. et al., DNA Tension Probes to Map the Transient Piconewton Receptor Forces by Immune Cells. J. Vis. Exp. (2021)
The video demonstrates a method for assessing receptor forces applied by immune cells using polyethylene glycol-anchored gold nanoparticles and DNA hairpin tension probes. CD8-positive T cell interactions trigger probe unfolding, emitting fluorescence while locking strands sustain the signal for quantifying the forces applied by immune cells.
Protocol
1. Oligonucleotide preparation Dissolve the ligand strand deoxyribonucleic acid (DNA) in water (18.2 MΩ resistivity, used throughout the whole protocol). Vortex and spin down the solution with a tabletop centrifuge. Tune the volume of water such that the final concentration is 1 mM. Validate the concentration by using a nanodrop spectrophotometer to measure the absorbance at 260 nm and determine the final concentration based on the extinction coefficient of the oligonucleotide. <br …
Representative Results
Figure 1: Examples of oligonucleotide preparation. (A) HPLC chromatogram of Cy3B ligand strand purification; (B) MALDI-TOF-MS spectra of the product; (C) Table of the calculated mass and found m/z peaks of the starting material and the labeled oligonucleotide. <img alt="Figur…
Divulgaciones
The authors have nothing to disclose.
Materials
| 3-hydroxypicolinic acid (3-HPA) | Sigma | 56197 | Maldi-TOF-MS matrix |
| mPEG-SC | Biochempeg | MF001023-2K | Surface prep |
| (3-Aminopropyl)triethoxysilane | Acros | AC430941000 | Surface prep |
| 10x Red blood cell lysis buffer | Biolegend | 00-4333-57 | Buffer |
| 8.8 nm gold nanoparticles, tannic acid | Nanocomposix | customized order | Surface prep |
| Atto647N NHS ester | Sigma | 18373-1MG-F | Fluorophore, oligo prep |
| Attofluor Cell Chamber, for microscopy | Thermo Fisher Scientific | A7816 | Imaging |
| BD Syringes only with Luer-Lok | BD bioscience | 309657 | Cells |
| Biotinylated anti-mouse CD3e | ebioscience | 13-0031-82 | Antibody/ligand |
| Biotinylated pMHC ovalbumin (SIINFEKL) | NIH Tetramer Core Facility at Emory University | NA | Antibody/ligand |
| Bovine serum albumin | Sigma | 735078001 | Block non-specific interactions |
| Cell strainers | Biologix | 15-1100 | Cells |
| Coverslip Mini-Rack, teflon | Thermo Fisher Scientific | C14784 | Surface prep |
| Cy3B NHS ester | GE Healthcare | PA63101 | Fluorophore, oligo prep |
| Dulbecco's phosphate-buffered saline (DPBS) | Corning | 21-031-CM | Buffer |
| Ethanol | Sigma | 459836 | Surface prep |
| Hank's balanced salts (HBSS) | Sigma | H8264 | Buffer |
| Hydrogen peroxide | Sigma | H1009 | Surface prep |
| LA-PEG-SC | Biochempeg | HE039023-3.4K | Surface prep |
| Midi MACS (LS) startup kit | Miltenyi Biotec | 130-042-301 | Cells |
| Mouse CD8+ T cell isolation kit | Miltenyi Biotec | 130-104-075 | Cells |
| Nanosep MF centrifugal devices | Pall laboratory | ODM02C35 | Oligo prep |
| No. 2 round glass coverslips | VWR | 48382-085 | Surface prep |
| NTA-SAM | Dojindo Molecular Technologies | N475-10 | Surface prep |
| P2 gel | Bio-rad | 1504118 | Oligo prep |
| Sulfuric acid | EMD Millipore Corporation | SX1244-6 | Surface prep |
| Sulfo-NHS acetate | Thermo Fisher Scientific | 26777 | Surface prep |
| Equipment | |||
| Agilent AdvanceBio Oligonucleotide C18 column, 4.6 x 150 mm, 2.7 μm | 653950-702 | Oligonucleotide preparation | |
| Barnstead Nanopure water purifying system | Thermo Fisher | Water | |
| CFI Apo 100× NA 1.49 objective | Nikon | Microscopy | |
| Cy5 cube | CHROMA | Microscopy | |
| Evolve electron multiplying charge coupled device (EMCCD) | Photometrics | Microscopy | |
| High-performance liquid chromatography | Agilent 1100 | Oligonucleotide preparation | |
| Intensilight epifluorescence source | Nikon | Microscopy | |
| Matrix-assisted laser desorption/ionization time-of-flight mass spectrometer (MALDI-TOF-MS) | Voyager STR | Oligonucleotide preparation | |
| Nanodrop 2000 UV-Vis Spectrophotometer | Thermo Fisher | Oligonucleotide preparation | |
| Nikon Eclipse Ti inverted microscope | Nikon | Microscopy | |
| Nikon Perfect Focus System | Nikon | Microscopy | |
| NIS Elements software | Nikon | Microscopy | |
| Quad band TIRF 405/488/561/647 cube | CHROMA | Microscopy | |
| RICM cube | CHROMA | Microscopy | |
| TIRF launcher with 488 nm (50 mW), 561 nm (50 mW), and 640 nm | Coherent | Microscopy | |
| TRITC cube | CHROMA | Microscopy | |
| Oligo name | 5' modification / 3' modification | Sequence (5' to 3') | Use |
| 15mer amine locking strand | 5' modification: no modification 3' modification: /3AmMO/ |
AAA AAA CAT TTA TAC CCT ACC TA | Locking real-time tension signal |
| 15mer Atto647N locking strand | 5' modification: Atto647N 3' modification: /3AmMO/ |
AAA AAA CAT TTA TAC CCT ACC TA | Locking real-time tension signal |
| 15mer non-fluoresccent locking strand | 5' modification: no modification 3' modification: no modification |
A AAA AAC ATT TAT AC | Locking real-time tension signal for quantitative analysis |
| 4.7 pN hairpin strand | 5' modification: no modification 3' modification: no modification |
GTGAAATACCGCACAGATGCGT TTGTATAAATGTTTTTTTCATTTAT ACTTTAAGAGCGCCACGTAGCC CAGC |
Hairpin probe |
| Amine ligand strand | 5' modification: /5AmMC6/ 3' modification: /3Bio/ |
CGCATCTGTGCG GTA TTT CAC TTT | Hairpin probe |
| BHQ2 anchor strand | 5' modification: /5ThiolMC6-D/ 3' modification: /3BHQ_2/ |
TTTGCTGGGCTACGTGGCGCTCTT | Hairpin probe |
| Cy3B ligand strand | 5' modification: Cy3B 3' modification: /3Bio/ |
CGCATCTGTGCG GTA TTT CAC TTT | Hairpin probe |
| Unlocking strand | 5' modification: no modification 3' modification: no modification |
TAG GTA GGG TAT AAA TGT TTT TTT C | Unlocking accumulated tension signal |
Tags
Citar este artículo
Using DNA-Based Tension Probes to Assess Receptor Forces Applied by Immune Cells. J. Vis. Exp. (Pending Publication), e21989, doi: (2024).