Single-Copy Gene Locus Chromatin Purification in Saccharomyces cerevisiae (맥주효모균의 단일 복제 유전자 자리, 염색질 정제)
Summary
이 프로토콜은 신진 효모인 맥주효모균(Saccharomyces cerevisiae)에서 네이티브 염색질 맥락에서 관심 있는 단일 복제 유전자 자리를 정제하기 위해 부위 특이적 재조합을 기반으로 하는 유전자좌 특이적 염색질 분리 방법을 제시합니다.
Abstract
진핵 염색질의 기본 조직 단위는 뉴클레오솜 코어 입자 (NCP)이며, 이는 히스톤 옥타머 주위에 ~ 1.7 배 감싼 DNA로 구성됩니다. 크로마틴은 NCP와 전사 인자, 염색질 리모델링 및 변형 효소를 포함한 수많은 다른 단백질 복합체의 실체로 정의됩니다. 이러한 단백질-DNA 상호 작용이 세포주기의 여러 단계에서 특정 게놈 위치 수준에서 어떻게 조정되는지는 아직 불분명합니다. 이는 주로 현재의 기술적 한계로 인해 이러한 동적 상호 작용의 정확한 측정값을 얻기가 어렵기 때문입니다. 여기서는 부위 특이적 재조합과 효율적인 단일 단계 친화성 정제 프로토콜을 결합하여 네이티브 염색질 상태에서 단일 복제 관심 유전자 자리를 분리하는 개선된 방법을 설명합니다. 이 방법은 게놈 크로마틴에 대한 표적 자리의 강력한 농축을 허용하므로 이 기술은 질량 분석법과 같은 편향되지 않고 체계적인 방식으로 단백질 상호 작용을 식별하고 정량화하기 위한 효과적인 전략이 됩니다. 이러한 조성 분석에 더하여, 이 방법에 의해 정제된 천연 염색질은 뉴클레오솜 위치 지정 및 히스톤 변형에 관한 생체 내 상황을 반영할 가능성이 높으며, 따라서 효모의 거의 모든 게놈 유전자좌에서 유래한 염색질의 추가 구조 및 생화학적 분석에 적합합니다.
Introduction
진핵생물 게놈을 염색질로 역동적으로 조직하면 DNA가 핵의 한계 내에 맞도록 압축되는 동시에 유전자 발현을 위한 충분한 역학과 조절 인자에 대한 접근성을 보장합니다. 부분적으로, 이 다재다능함은 히스톤 옥타머1 주위에 ~1.7배 감싼 DNA의 147 bp를 가진 핵심 입자를 포함하는 염색질의 기본 단위인 뉴클레오솜에 의해 매개됩니다. 뉴클레오솜은 N- 및 C-말단 히스톤 꼬리에 수많은 히스톤 변이체와 번역 후 변형(PTM)이 있는 구성과 관련하여 매우 역동적인 구조입니다. 또한 진핵 염색질은 전사 인자, DNA 및 RNA 처리 기계, 건축 단백질, 염색질 리모델링 및 변형에 관여하는 효소, 염색질과 관련된 RNA 분자와 같은 다양한 다른 필수 구성 요소와 상호 작용합니다. 전사, 복제 및 복구와 관련된 이러한 중요한 기계는 모두 이러한 과정의 천연 기질 역할을 하는 크로마틴에 대한 접근이 필요합니다. 결과적으로, 이러한 DNA 거래의 기초가 되는 분자 메커니즘을 이해하려면 이러한 기계가 수렴하고 생물학적 반응을 촉진하는 특정 게놈 영역에서 염색질 구조의 집합적 변화를 정확하게 정의해야 합니다.
유전학 및 단백질-단백질 상호 작용 연구를 통해 수많은 염색질 인자를 식별했음에도 불구하고 특정 게놈 부위에서 염색질 상호 작용에 대한 직접적이고 편향되지 않은 포괄적인 분석을 수행하는 것은 중요한 장애물로 남아 있습니다 2,3. 초기에는 게놈의 매우 풍부한 영역(즉, 반복적 유전자좌) 또는 다중 복제 플라스미드만 관련 단백질 4,5,6,7의 질량 분석 식별을 위해 충분한 양과 순도로 분리할 수 있었습니다. 크로마틴화된 DNA에 대한 포획 프로브의 직접 하이브리드화, CRISPR-dCas9 시스템을 사용한 근접 비오틴화 또는 염기서열 특이적 어댑터 단백질을 관심 유전자좌에 결합하는 것을 기반으로 하는 일련의 새로운 접근 방식은 효모 및 포유류 게놈 8,9,10에서 단일 복제 유전자좌의 단백질체를 풀기 시작했습니다. 그러나 이러한 모든 방법은 단백질-DNA 상호 작용을 안정화하기 위해 포름 알데히드 교차 결합과 후속 정제를 위해 염색질을 용해시키기 위해 초음파 처리가 필요합니다. 두 조작 모두 정제된 크로마틴의 후속 구조적 및 기능적 연구 가능성을 배제합니다.
이러한 한계를 극복하기 위해 우리는 이전에 효모11,12에서 표적 염색체 도메인을 추출하기 위해 부위 특이적 재조합을 사용하는 방법론을 고안했습니다. 본질적으로, 관심의 게놈 영역은 Zygosaccharomyces rouxi의 부위 특이적 R-재조합효소에 대한 인식 부위(RS)로 둘러싸여 있으며, 동시에 동일한 영역 내에서 원핵생물 전사 억제제 LexA 단백질(LexA)에 대한 3개의 DNA 결합 부위 그룹을 통합합니다. 효모 세포에는 R-재조합효소의 동시 발현을 위한 발현 카세트와 탠덤 친화성 정제(TAP) 태그에 융합된 LexA 단백질이 포함되어 있습니다. R-재조합효소의 유도 후, 효소는 원형 염색질 도메인의 형태로 염색체에서 표적 영역을 효율적으로 절제합니다. 이 도메인은 LexA DNA 결합 부위와 친화성 지지체에 결합하는 LexA-TAP 어댑터 단백질을 통해 정제할 수 있습니다. 이 방법은 효모 염색체 III13의 선택된 복제 기원을 포함하는 뚜렷한 염색질 도메인을 분리하는 데 최근에 사용되었습니다.
이 생체 외 접근법의 주요 장점 중 하나는 분리된 물질의 기능적 분석이 가능하다는 것입니다. 예를 들어, 이 방법으로 정제된 복제 기원 도메인은 in vitro 복제 분석을 통해 native in vivo 조립 염색질 템플릿으로부터 시험관에서 기원 발화의 효율성을 평가할 수 있습니다. 궁극적으로, 분리된 물질의 생화학적 및 기능적 특성화는 천연 염색질 주형과 함께 정제된 단백질을 사용하여 핵 공정의 재구성을 허용할 수 있습니다. 요약하면, 이 방법론은 특정 염색체 거래를 겪는 특정 게놈 영역의 집합적 구성 및 구조적 염색질 변화를 추적할 수 있기 때문에 염색질 연구에서 흥미로운 길을 열어줍니다.
Protocol
Representative Results
Discussion
특정 표적 게놈 영역의 인자 및 염색질 지형을 식별하는 것은 염색질 연구에서 계속해서 주요 과제를 제기하고 있다18. 이 프로토콜은 효모 염색체에서 뚜렷한 염색질 도메인을 특이적으로 절제하고 정제하는 효율적인 시스템을 설명합니다. 우리가 아는 한, 이 단일 단계 정제의 순도와 수율은 유전자좌 특이적 염색질 정제 방법의 많은 한계를 극복하여 다른 관련 없는 게놈 영?…
Offenlegungen
The authors have nothing to disclose.
Acknowledgements
S.H. 실험실에서의 작업은 SFB1064(프로젝트 ID 213249687), 유럽 연구 위원회(ERC Starting Grant 852798 ConflictResolution) 및 Helmholtz Gesellschaft를 통해 DFG의 지원을 받았습니다.
Materials
| Yeast strains | |||
| Control Strain: MATa; ura3Δ0; leu2Δ0; his3Δ1; met15Δ0; bar1::kanMX4; Chr I 212kb::LEU2 pTEF2-LEXA-TAP pGAL1-10 RecR | Section 1, see references 13 and 14 | ||
| Recombination Strain: MATa; ura3Δ0; leu2Δ0; his3Δ1; met15Δ0; bar1::kanMX4; RS_LEXA_NS-3_ARS316_NS+3_RS; Chr I 212kb::LEU2 pTEF2-LEXA-TAP pGAL1-10 RecR | Section 1, see reference 13 and 14 | ||
| Plasmid | |||
| K238 plasmid | Section 1, see reference 13 Storage: Store at -20 °C |
||
| K071 Spike-in plasmid DNA | Section 7.1, see reference 13 Storage: Store at -20 °C |
||
| Reagents | |||
| Acetone | Carl Roth | 5025.1 | Section 2 Storage: Store at room temperature |
| Ammonium acetate (NH4Ac) | Sigma Aldrich | A7262 | Section 6 and 7.1 Storage: Store at room temperature |
| Ammonium solution (NH4OH) 25% | Merck Millipore | 533003 | Section 6 Storage: Store at room temperature |
| Ammonium sulfate | Santa Cruz | Sc-29085 | Section 2 Storage: Store at room temperature |
| Bacto agar | BD (VWR) | 90000-760 | Section 3 Storage: Store at room temperature |
| Bacto peptone | BD (VWR) | 211820 | Section 3 Storage: Store at room temperature |
| β-Mercaptoethanol | Sigma Aldrich | 07604 | Section 7.2 Storage: Store at 4 °C |
| Chemiluminescent substrate kit | ThermoFisher | 34580 | Section 7.2 Storage: Store at 4 °C |
| Di-Sodium Hydrogen phosphate dodecahydrate | Merck | 1.06579.1000 | Section 2 and 7.1 Storage: Store at room temperature |
| Dithiothreitol (DTT) | ThermoFisher | 15508013 | Section 4 Storage: Store at 4 °C |
| Ethanol | Merck | 100983 | Section 7.1 Storage: Store at room temperature |
| Ethylenediaminetetraacetic acid (EDTA) | Sigma Aldrich | ED | Section 7.1 Storage: Store at room temperature |
| Galactose (20% (w/v) stock) | Sigma Aldrich | G0625-1KG / 5KG | Section 3 Storage: Store at room temperature |
| Gel loading dye (6x) | BioLabs | B7024A | Section 7.1 Storage: Store at -20 °C |
| Glusose | Sigma-Aldrich | G8270 | Section Storage: Store at room temperature |
| Glycine | Carl Roth | .0079.4 | Section 2 Storage: Store at room temperature |
| Glycogen (5 mg/mL) | Invitrogen | AM9510 | Section 7.1 Storage: Store at -20 °C |
| Hydrochloric acid (HCl) | PanReac AppliChem | 182109.1211 | Section 2, 4 and 7.1 Storage: Store at room temperature |
| Magnesium Acetate (MgAc) | Bernd Kraft | 15274.2600/C035 | Section 4 Storage: Store at room temperature |
| Magnesium chloride (MgCl2) | Sigma Aldrich | M8266 | Section 6 Storage: Store at room temperature |
| Nu PAGE LDS sample buffer (4x) | Invitrogen | 2399549 | Section 7.2 Storage: Store at room temperature |
| Phenol/Chloroform/Isoamyl alcohol (25:24:1 v/v) | Invitrogen | 15593-031 | Section 7.1 Storage: Store at 4 °C |
| Potassium chloride (KCl) | Sigma | P9541 | Section 4 Storage: Store at room temperature |
| Radioactively labeled α-32P dATP (3,000 Ci/mmol, 10 mCi/mL) | Hartmann Analytic | SRP-203 | Section 7.1 Storage: Store at 4 °C |
| RadPrime labeling system | ThermoFisher | 18428-011 | Section 7.1 Storage: Store at -20 °C |
| Raffinose (20% (w/v) stock) | SERVA | 34140.03 | Section 3 Storage: Store at room temperature |
| Sodium chloride (NaCl) | Merck | K53710504142 | Section 7.1 Storage: Store at room temperature |
| Sodium citrate (Na3C6H5O7) | Sigma-Aldrich | 71402 | Section 7.1 Storage: Store at room temperature |
| Sodium hydroxide (NaOH) | Sigma Aldrich | S5881 | Section 7.1 Storage: Store at room temperature |
| Sodium n-dodecyl sulfate (SDS) (5% stock (w/v) ) | Alfa Aesar | A11183 | Section 7.1 Storage: Store at room temperature |
| Sodium phosphate monobasic | Sigma-Aldrich | 71496 | Section 2 and 7.1 Storage: Store at room temperature |
| Sodium azide | Santa Cruz Biotechnology | sc-208393 | Section 2 Storage: Store at -20 °C |
| Triethylamine | Sigma Aldrich | 90340 | Section 2 Storage: Store at room temperature |
| Tris base | Chem Cruz | SC-3715B | Section 2 and 4 Storage: Store at room temperature |
| Triton X-100 | Sigma Aldrich | X100 | Section 2 and 4 Storage: Store at room temperature |
| Tween-20 | Bernd Kraft | 18014332 | Section 4 Storage: Store at room temperature |
| Yeast extract | BD (VWR) | 212720 | Section 3 Storage: Store at room temperature |
| Yeast mating factor alpha (1 µg/mL stock ) | Biomol | Y2016.5 | Section 3 Storage: Store at -20 °C |
| Yeast Synthetic Drop-out medium Supplements without LEUCINE | Sigma Aldrich | Y1376 | Section 1, see reference 14 |
| Enzymes | |||
| HpaI restriction enzyme (5,000 U/mL) | NEB | R0105S | Section 7.1 Storage: Store at -20 °C |
| Protease and Phosphatase Inhibitor Cocktail (100x) | ThermoFisher Scientific | 78446 | Section 4 Storage: Store at4 °C |
| Proteinase K (10 mg/mL) | SERVA | 33756 | Section 7.1 Storage: Store at -20 °C |
| RNase A (10 mg/mL) | ThermoFisher | EN0531 | Section 7.1 Storage: Store at -20 °C |
| TEV protease (10000 U/µL) | NEB | P8112S | Section 5 Storage: Store at -20 °C |
| Materials | |||
| BcMag Epoxy-Activated Magnetic Beads | Bioclone Inc. | FC-102 | Section 2 Storage: Store at 4 °C |
| Dry ice | Section 4 | ||
| Low-binding centrifuge tubes 2.0 mL | Eppendorf | 22431102 | Section 4 |
| Microspin G-25 Columns | Cytiva | 27-5325-01 | Section 7.1 Storage: Store at room temperature |
| Parafilm | Merck | P7793 | Section 4 |
| Positive nylon membrane | Biozol | 11MEMP0001 | Section 7.1 Storage: Store at room temperature |
| PVDF transfer membrane | Immobilon-Merck Millipore | IPVH00010 | Section 7.2 Storage: Store at room temperature |
| SDS-PAGE gel 4-12% bis-tris (15 well, 1.5 mm) | Invitrogen | NP0336BOX | Section 7.2 Storage: Store at 4 °C |
| Syringe (25 mL) with luer fitting | Henke Sass Wolf | 4200-000V0 | Section 3 |
| Whatman paper (Grade 3MM CHR Cellulose Western Blotting Paper Sheet) | Cytiva | 3030-917 | Section 7.1 Storage: Store at room temperature |
| Antibodies | |||
| Anti-LexA, rabbit polyclonal IgG, DNA binding region antibody | Merck Millipore | 06-719 | Section 7.2 Storage: Store at -20 °C |
| Goat Anti-Rabbit IgG (H+L), Horseradish peroxidase conjugate | Invitrogen | G21234 | Section 7.2 Storage: Store at -20 °C |
| Peroxidase Anti-Peroxidase (PAP) antibody produced in rabbit for the detection of TAP-tagged proteins | Sigma Aldrich | P1291-500UL | Section 7.2 Storage: Store at -20 °C |
| Rabbit IgG antibodies | Sigma | I5006-100MG | Section 2 Storage: Store at 4 °C |
| Primers (10 µM) | |||
| ARS316: fwd 5'- CGGCATTATCGTACACAACCT, rev 5'- GTTCTTCGTTGCCTACATTTTCT | Section 7.1 | ||
| K071 Spike-in plasmid DNA: fwd: 5'-TTTTCGCTGCTTGTCCTTTT, rev 5'- CATTTTCGTCCTCCCAACAT | Section 7.1 | ||
| PCR fragment from yeast genomic DNA as a template for ARS316 amplification (for southern blot): fwd 5’- AAATTCTGCCCTTGATTCGT rev 5’- TTTGTTTATCTCATCACTAAT | Section 7.1 | ||
| PDC1: fwd 5'- CATGATCAGATGGGGCTTCA, rev 5'-ACCGGTGGTAGCGACTCTGT | Section 7.1 | ||
| Equipment | |||
| Coffee grinder | Gastroback | 42601 | Section 4 |
| Dewar flask | NAL GENE | 4150-2000 | Section 3 |
| DynaMag TM-2 magnetic rack | Invitrogen | 12321D | Section 4, 5 and 6 |
| Hybridization oven | Hybaid Mini10 | Ri418 | Section 2 |
| Microcentrifuge | Eppendorf | 5424R | Section 4 and 7.1 |
| UV-crosslinker | Analytikjena | 95-0174-02 | Section 7.1 |
Referenzen
- Kornberg, R. D., Lorch, Y. Twenty-five years of the nucleosome, fundamental particle of the eukaryote chromosome. Cell. 98 (3), 285-294 (1999).
- Gauchier, M., van Mierlo, G., Vermeulen, M., Déjardin, J. Purification and enrichment of specific chromatin loci. Nature Methods. 17 (4), 380-389 (2020).
- Korthout, T., et al. Decoding the chromatin proteome of a single genomic locus by DNA sequencing. PLoS Biology. 16 (7), e2005542 (2018).
- Antão, J. M., Mason, J. M., Déjardin, J., Kingston, R. E. Protein landscape at Drosophila melanogaster telomere-associated sequence repeats. Molecular and Cellular Biology. 32 (12), 2170-2182 (2012).
- Déjardin, J., Kingston, R. E. Purification of proteins associated with specific genomic loci. Cell. 136 (1), 175-186 (2009).
- Ide, S., Dejardin, J. End-targeting proteomics of isolated chromatin segments of a mammalian ribosomal RNA gene promoter. Nature Communications. 6, 6674 (2015).
- Unnikrishnan, A., Gafken, P. R., Tsukiyama, T. Dynamic changes in histone acetylation regulate origins of DNA replication. Nature Structural & Molecular Biology. 17 (4), 430 (2010).
- Buxton, K. E., et al. Elucidating protein-DNA interactions in human alphoid chromatin via hybridization capture and mass spectrometry. Journal of Proteome Research. 16 (9), 3433-3442 (2017).
- Kennedy-Darling, J., et al. Discovery of chromatin-associated proteins via sequence-specific capture and mass spectrometric protein identification in Saccharomyces cerevisiae. Journal of Proteome Research. 13 (8), 3810-3825 (2014).
- Liu, S. J., et al. CRISPRi-based genome-scale identification of functional long noncoding RNA loci in human cells. Science. 355, 7111 (2017).
- Hamperl, S., et al. Purification of specific chromatin domains from single-copy gene loci in Saccharomyces cerevisiae. Functional Analysis of DNA and Chromatin. 1094, 329-341 (2014).
- Hamperl, S., et al. Compositional and structural analysis of selected chromosomal domains from Saccharomyces cerevisiae. Nucleic Acids Research. 42 (1), 2 (2014).
- Weiβ, M. Single-copy locus proteomics of early- and late-firing DNA replication origins identifies a role of Ask1/DASH complex in replication timing control. Cell Reports. 42 (2), 112045 (2023).
- Gietz, R. D., Schiestl, R. H. High-efficiency yeast transformation using the LiAc/SS carrier DNA/PEG method. Nature Protocols. 2 (1), 31-34 (2007).
- Laemmli, U. K. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature. 227 (5259), 680-685 (1970).
- Towbin, H., Staehelin, T., Gordon, J. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proceedings of the National Academy of Sciences of the United States of America. 76 (9), 4350-4354 (1979).
- Western blot membrane stripping for restaining protocol. Abcam Available from: https://www.abcam.com/protocols/western-blot-membrane-stripping-for-restaining-protocol (2023)
- Vermeulen, M., Déjardin, J. Locus-specific chromatin isolation. Nature Reviews. Molecular Cell Biology. 21 (5), 249-250 (2020).
