עותק יחיד של גן לוקוס כרומטין טיהור ב Saccharomyces cerevisiae
Summary
פרוטוקול זה מציג שיטת בידוד כרומטין ספציפית ללוקוס המבוססת על רקומבינציה ספציפית לאתר כדי לטהר מוקד גן בעל עניין של עותק יחיד בהקשר הכרומטין הטבעי שלו משמרים ניצנים, Saccharomyces cerevisiae.
Abstract
היחידה הארגונית הבסיסית של הכרומטין האיקריוטי היא חלקיק הליבה הנוקלאוזומי (NCP), המורכב מדנ”א עטוף ~1.7 פעמים סביב אוקטמר היסטון. כרומטין מוגדר כישות של NCPs וקומפלקסים חלבוניים רבים אחרים, כולל גורמי שעתוק, עיצוב מחדש של כרומטין ושינוי אנזימים. עדיין לא ברור כיצד אינטראקציות חלבון-דנ”א אלה מתוזמרות ברמה של אתרים גנומיים ספציפיים במהלך שלבים שונים של מחזור התא. זה בעיקר בשל המגבלות הטכניות הנוכחיות, אשר מקשות על השגת מדידות מדויקות של אינטראקציות דינמיות כאלה. כאן, אנו מתארים שיטה משופרת המשלבת רקומבינציה ספציפית לאתר עם פרוטוקול טיהור זיקה יעיל בצעד אחד כדי לבודד מוקד גן בעל עניין בעותק יחיד במצב הכרומטין הטבעי שלו. השיטה מאפשרת העשרה איתנה של מוקד המטרה על פני כרומטין, מה שהופך טכניקה זו לאסטרטגיה יעילה לזיהוי וכימות אינטראקציות חלבונים באופן בלתי משוחד ושיטתי, למשל על ידי ספקטרומטריית מסות. בהמשך לניתוחי הרכב כאלה, כרומטין טבעי שטוהר בשיטה זו משקף ככל הנראה את המצב in vivo בנוגע למיקום נוקלאוזומים ושינויים בהיסטון, ולכן ניתן לבצע ניתוחים מבניים וביוכימיים נוספים של כרומטין הנגזר כמעט מכל מוקד גנומי בשמרים.
Introduction
הארגון הדינמי של גנומים אאוקריוטים לכרומטין דוחס את הדנ”א כך שיתאים לגבולות הגרעין תוך הבטחת דינמיקה מספקת לביטוי גנים ונגישות לגורמים רגולטוריים. בין השאר, רב-תכליתיות זו מתווכת על ידי הנוקלאוזום, היחידה הבסיסית של כרומטין, המורכבת מחלקיק ליבה עם 147 bp של DNA עטוף ~ 1.7 פעמים סביב אוקטמר היסטון1. הנוקלאוזום, הוא מבנה דינמי מאוד ביחס להרכבו, עם גרסאות היסטון רבות ושינויים פוסט-תרגומיים (PTM) על זנבות ההיסטון N ו-C. יתר על כן, כרומטין אאוקריוטי מקיים אינטראקציה עם מספר רב של מרכיבים חיוניים אחרים, כגון גורמי שעתוק, מכונות עיבוד DNA ו- RNA, חלבונים ארכיטקטוניים, אנזימים המעורבים בעיצוב מחדש ושינוי של כרומטין, ומולקולות RNA הקשורות לכרומטין. מכונות חיוניות אלה המעורבות בשעתוק, שכפול ותיקון דורשות גישה לכרומטין, המשמש כמצע הטבעי לתהליכים אלה. כתוצאה מכך, הבנת המנגנונים המולקולריים העומדים בבסיס עסקאות דנ”א אלה מחייבת הגדרה מדויקת של השינויים הקולקטיביים במבנה הכרומטין באזורים הגנומיים הספציפיים שבהם מכונות אלה מתכנסות ומאפשרות תגובות ביולוגיות.
למרות הזיהוי של גורמי כרומטין רבים באמצעות גנטיקה ומחקרי אינטראקציה חלבון-חלבון, ביצוע ניתוחים ישירים, בלתי משוחדים ומקיפים של אינטראקציות כרומטין באתרים גנומיים מסוימים נותר מכשול משמעותי 2,3. בתחילה, ניתן היה לבודד רק אזורים שופעים מאוד של הגנום (כלומר, לוקי חוזר) או פלסמידים מרובי עותקים בכמויות וטוהר מספיקים לזיהוי ספקטרומטרי מסה של החלבונים הקשורים 4,5,6,7. סדרה של גישות חדשות המבוססות על הכלאה ישירה של גשושיות לכידה לדנ”א כרומטיני, ביוטינילציה של קרבה באמצעות מערכת CRISPR-dCas9, או קשירה של חלבוני מתאם ספציפיים לרצף למוקד העניין החלו לפענח את הפרוטאום של אתרים בעלי עותק יחיד מגנומים של שמרים ויונקים 8,9,10. עם זאת, כל השיטות הללו דורשות הצלבת פורמלדהיד כדי לייצב את אינטראקציות החלבון-דנ”א וסוניקציה כדי להמיס את הכרומטין לטיהור לאחר מכן. יחד, שתי המניפולציות שוללות את האפשרות של מחקרים מבניים ופונקציונליים הבאים של הכרומטין המטוהר.
כדי להתגבר על מגבלות אלה, פיתחנו בעבר מתודולוגיה המשתמשת ברקומבינציה ספציפית לאתר כדי לחלץ תחומים כרומוזומליים ממוקדים משמרים11,12. בעיקרו של דבר, האזור הגנומי המעניין מוקף באתרי זיהוי (RS) עבור R-רקומבינאז ספציפי לאתר מ- Zygosaccharomyces rouxi ובו זמנית משלב קבוצה של שלושה אתרי קישור DNA עבור חלבון מדכא השעתוק הפרוקריוטי LexA (LexA) באותו אזור. תאי השמרים מכילים קסטת ביטוי לביטוי סימולטני של R-רקומבינאז וחלבון LexA המאוחה לתג טיהור זיקה טנדם (TAP). לאחר השראת R-רקומבינאז, האנזים מוציא ביעילות את אזור המטרה מהכרומוזום בצורה של תחום כרומטין מעגלי. ניתן לטהר תחום זה באמצעות חלבון מתאם LexA-TAP, הנקשר לאתרי קשירת הדנ”א של LexA, כמו גם לתמיכה באהדה. שיטה זו שימשה לאחרונה לבידוד תחומי כרומטין נפרדים המכילים מקורות שכפול נבחרים של כרומוזום שמרים III13.
אחד היתרונות העיקריים של גישת ex vivo זו הוא שהיא מאפשרת ניתוחים פונקציונליים של החומר המבודד. לדוגמה, תחומי מקור שכפול שטוהרו בשיטה זו יכולים להיות נתונים למבחני שכפול חוץ גופיים כדי להעריך את יעילות ירי המקור במבחנה מתבניות כרומטין מורכבות מקוריות in vivo . בסופו של דבר, האפיון הביוכימי והפונקציונלי של החומר המבודד עשוי לאפשר בנייה מחדש של תהליכים גרעיניים באמצעות חלבונים מטוהרים יחד עם תבנית הכרומטין המקורית. לסיכום, מתודולוגיה זו פותחת אפיק מרתק במחקר הכרומטין, שכן ניתן יהיה לעקוב אחר השינויים הקולקטיביים בהרכב ובמבנה הכרומטין של אזור גנומי מסוים העובר טרנזקציה כרומוזומלית מסוימת.
Protocol
Representative Results
Discussion
זיהוי הגורמים ונוף הכרומטין של אזור גנומי מטרה ספציפי ממשיך להוות אתגר מרכזי במחקר הכרומטין18. פרוטוקול זה מתאר מערכת יעילה לכריתה וטיהור ספציפית של תחומי כרומטין נפרדים מכרומוזומי שמרים. למיטב ידיעתנו, הטוהר והתשואה של טיהור חד-שלבי זה מתגברים על רבות מהמגבלות של שיטות טיהו?…
Offenlegungen
The authors have nothing to disclose.
Acknowledgements
העבודה במעבדת S.H. נתמכה על ידי DFG באמצעות SFB1064 (מזהה פרויקט 213249687), מועצת המחקר האירופית (ERC Starting Grant 852798 ConflictResolution) והלמהולץ Gesellschaft.
Materials
| Yeast strains | |||
| Control Strain: MATa; ura3Δ0; leu2Δ0; his3Δ1; met15Δ0; bar1::kanMX4; Chr I 212kb::LEU2 pTEF2-LEXA-TAP pGAL1-10 RecR | Section 1, see references 13 and 14 | ||
| Recombination Strain: MATa; ura3Δ0; leu2Δ0; his3Δ1; met15Δ0; bar1::kanMX4; RS_LEXA_NS-3_ARS316_NS+3_RS; Chr I 212kb::LEU2 pTEF2-LEXA-TAP pGAL1-10 RecR | Section 1, see reference 13 and 14 | ||
| Plasmid | |||
| K238 plasmid | Section 1, see reference 13 Storage: Store at -20 °C |
||
| K071 Spike-in plasmid DNA | Section 7.1, see reference 13 Storage: Store at -20 °C |
||
| Reagents | |||
| Acetone | Carl Roth | 5025.1 | Section 2 Storage: Store at room temperature |
| Ammonium acetate (NH4Ac) | Sigma Aldrich | A7262 | Section 6 and 7.1 Storage: Store at room temperature |
| Ammonium solution (NH4OH) 25% | Merck Millipore | 533003 | Section 6 Storage: Store at room temperature |
| Ammonium sulfate | Santa Cruz | Sc-29085 | Section 2 Storage: Store at room temperature |
| Bacto agar | BD (VWR) | 90000-760 | Section 3 Storage: Store at room temperature |
| Bacto peptone | BD (VWR) | 211820 | Section 3 Storage: Store at room temperature |
| β-Mercaptoethanol | Sigma Aldrich | 07604 | Section 7.2 Storage: Store at 4 °C |
| Chemiluminescent substrate kit | ThermoFisher | 34580 | Section 7.2 Storage: Store at 4 °C |
| Di-Sodium Hydrogen phosphate dodecahydrate | Merck | 1.06579.1000 | Section 2 and 7.1 Storage: Store at room temperature |
| Dithiothreitol (DTT) | ThermoFisher | 15508013 | Section 4 Storage: Store at 4 °C |
| Ethanol | Merck | 100983 | Section 7.1 Storage: Store at room temperature |
| Ethylenediaminetetraacetic acid (EDTA) | Sigma Aldrich | ED | Section 7.1 Storage: Store at room temperature |
| Galactose (20% (w/v) stock) | Sigma Aldrich | G0625-1KG / 5KG | Section 3 Storage: Store at room temperature |
| Gel loading dye (6x) | BioLabs | B7024A | Section 7.1 Storage: Store at -20 °C |
| Glusose | Sigma-Aldrich | G8270 | Section Storage: Store at room temperature |
| Glycine | Carl Roth | .0079.4 | Section 2 Storage: Store at room temperature |
| Glycogen (5 mg/mL) | Invitrogen | AM9510 | Section 7.1 Storage: Store at -20 °C |
| Hydrochloric acid (HCl) | PanReac AppliChem | 182109.1211 | Section 2, 4 and 7.1 Storage: Store at room temperature |
| Magnesium Acetate (MgAc) | Bernd Kraft | 15274.2600/C035 | Section 4 Storage: Store at room temperature |
| Magnesium chloride (MgCl2) | Sigma Aldrich | M8266 | Section 6 Storage: Store at room temperature |
| Nu PAGE LDS sample buffer (4x) | Invitrogen | 2399549 | Section 7.2 Storage: Store at room temperature |
| Phenol/Chloroform/Isoamyl alcohol (25:24:1 v/v) | Invitrogen | 15593-031 | Section 7.1 Storage: Store at 4 °C |
| Potassium chloride (KCl) | Sigma | P9541 | Section 4 Storage: Store at room temperature |
| Radioactively labeled α-32P dATP (3,000 Ci/mmol, 10 mCi/mL) | Hartmann Analytic | SRP-203 | Section 7.1 Storage: Store at 4 °C |
| RadPrime labeling system | ThermoFisher | 18428-011 | Section 7.1 Storage: Store at -20 °C |
| Raffinose (20% (w/v) stock) | SERVA | 34140.03 | Section 3 Storage: Store at room temperature |
| Sodium chloride (NaCl) | Merck | K53710504142 | Section 7.1 Storage: Store at room temperature |
| Sodium citrate (Na3C6H5O7) | Sigma-Aldrich | 71402 | Section 7.1 Storage: Store at room temperature |
| Sodium hydroxide (NaOH) | Sigma Aldrich | S5881 | Section 7.1 Storage: Store at room temperature |
| Sodium n-dodecyl sulfate (SDS) (5% stock (w/v) ) | Alfa Aesar | A11183 | Section 7.1 Storage: Store at room temperature |
| Sodium phosphate monobasic | Sigma-Aldrich | 71496 | Section 2 and 7.1 Storage: Store at room temperature |
| Sodium azide | Santa Cruz Biotechnology | sc-208393 | Section 2 Storage: Store at -20 °C |
| Triethylamine | Sigma Aldrich | 90340 | Section 2 Storage: Store at room temperature |
| Tris base | Chem Cruz | SC-3715B | Section 2 and 4 Storage: Store at room temperature |
| Triton X-100 | Sigma Aldrich | X100 | Section 2 and 4 Storage: Store at room temperature |
| Tween-20 | Bernd Kraft | 18014332 | Section 4 Storage: Store at room temperature |
| Yeast extract | BD (VWR) | 212720 | Section 3 Storage: Store at room temperature |
| Yeast mating factor alpha (1 µg/mL stock ) | Biomol | Y2016.5 | Section 3 Storage: Store at -20 °C |
| Yeast Synthetic Drop-out medium Supplements without LEUCINE | Sigma Aldrich | Y1376 | Section 1, see reference 14 |
| Enzymes | |||
| HpaI restriction enzyme (5,000 U/mL) | NEB | R0105S | Section 7.1 Storage: Store at -20 °C |
| Protease and Phosphatase Inhibitor Cocktail (100x) | ThermoFisher Scientific | 78446 | Section 4 Storage: Store at4 °C |
| Proteinase K (10 mg/mL) | SERVA | 33756 | Section 7.1 Storage: Store at -20 °C |
| RNase A (10 mg/mL) | ThermoFisher | EN0531 | Section 7.1 Storage: Store at -20 °C |
| TEV protease (10000 U/µL) | NEB | P8112S | Section 5 Storage: Store at -20 °C |
| Materials | |||
| BcMag Epoxy-Activated Magnetic Beads | Bioclone Inc. | FC-102 | Section 2 Storage: Store at 4 °C |
| Dry ice | Section 4 | ||
| Low-binding centrifuge tubes 2.0 mL | Eppendorf | 22431102 | Section 4 |
| Microspin G-25 Columns | Cytiva | 27-5325-01 | Section 7.1 Storage: Store at room temperature |
| Parafilm | Merck | P7793 | Section 4 |
| Positive nylon membrane | Biozol | 11MEMP0001 | Section 7.1 Storage: Store at room temperature |
| PVDF transfer membrane | Immobilon-Merck Millipore | IPVH00010 | Section 7.2 Storage: Store at room temperature |
| SDS-PAGE gel 4-12% bis-tris (15 well, 1.5 mm) | Invitrogen | NP0336BOX | Section 7.2 Storage: Store at 4 °C |
| Syringe (25 mL) with luer fitting | Henke Sass Wolf | 4200-000V0 | Section 3 |
| Whatman paper (Grade 3MM CHR Cellulose Western Blotting Paper Sheet) | Cytiva | 3030-917 | Section 7.1 Storage: Store at room temperature |
| Antibodies | |||
| Anti-LexA, rabbit polyclonal IgG, DNA binding region antibody | Merck Millipore | 06-719 | Section 7.2 Storage: Store at -20 °C |
| Goat Anti-Rabbit IgG (H+L), Horseradish peroxidase conjugate | Invitrogen | G21234 | Section 7.2 Storage: Store at -20 °C |
| Peroxidase Anti-Peroxidase (PAP) antibody produced in rabbit for the detection of TAP-tagged proteins | Sigma Aldrich | P1291-500UL | Section 7.2 Storage: Store at -20 °C |
| Rabbit IgG antibodies | Sigma | I5006-100MG | Section 2 Storage: Store at 4 °C |
| Primers (10 µM) | |||
| ARS316: fwd 5'- CGGCATTATCGTACACAACCT, rev 5'- GTTCTTCGTTGCCTACATTTTCT | Section 7.1 | ||
| K071 Spike-in plasmid DNA: fwd: 5'-TTTTCGCTGCTTGTCCTTTT, rev 5'- CATTTTCGTCCTCCCAACAT | Section 7.1 | ||
| PCR fragment from yeast genomic DNA as a template for ARS316 amplification (for southern blot): fwd 5’- AAATTCTGCCCTTGATTCGT rev 5’- TTTGTTTATCTCATCACTAAT | Section 7.1 | ||
| PDC1: fwd 5'- CATGATCAGATGGGGCTTCA, rev 5'-ACCGGTGGTAGCGACTCTGT | Section 7.1 | ||
| Equipment | |||
| Coffee grinder | Gastroback | 42601 | Section 4 |
| Dewar flask | NAL GENE | 4150-2000 | Section 3 |
| DynaMag TM-2 magnetic rack | Invitrogen | 12321D | Section 4, 5 and 6 |
| Hybridization oven | Hybaid Mini10 | Ri418 | Section 2 |
| Microcentrifuge | Eppendorf | 5424R | Section 4 and 7.1 |
| UV-crosslinker | Analytikjena | 95-0174-02 | Section 7.1 |
Referenzen
- Kornberg, R. D., Lorch, Y. Twenty-five years of the nucleosome, fundamental particle of the eukaryote chromosome. Cell. 98 (3), 285-294 (1999).
- Gauchier, M., van Mierlo, G., Vermeulen, M., Déjardin, J. Purification and enrichment of specific chromatin loci. Nature Methods. 17 (4), 380-389 (2020).
- Korthout, T., et al. Decoding the chromatin proteome of a single genomic locus by DNA sequencing. PLoS Biology. 16 (7), e2005542 (2018).
- Antão, J. M., Mason, J. M., Déjardin, J., Kingston, R. E. Protein landscape at Drosophila melanogaster telomere-associated sequence repeats. Molecular and Cellular Biology. 32 (12), 2170-2182 (2012).
- Déjardin, J., Kingston, R. E. Purification of proteins associated with specific genomic loci. Cell. 136 (1), 175-186 (2009).
- Ide, S., Dejardin, J. End-targeting proteomics of isolated chromatin segments of a mammalian ribosomal RNA gene promoter. Nature Communications. 6, 6674 (2015).
- Unnikrishnan, A., Gafken, P. R., Tsukiyama, T. Dynamic changes in histone acetylation regulate origins of DNA replication. Nature Structural & Molecular Biology. 17 (4), 430 (2010).
- Buxton, K. E., et al. Elucidating protein-DNA interactions in human alphoid chromatin via hybridization capture and mass spectrometry. Journal of Proteome Research. 16 (9), 3433-3442 (2017).
- Kennedy-Darling, J., et al. Discovery of chromatin-associated proteins via sequence-specific capture and mass spectrometric protein identification in Saccharomyces cerevisiae. Journal of Proteome Research. 13 (8), 3810-3825 (2014).
- Liu, S. J., et al. CRISPRi-based genome-scale identification of functional long noncoding RNA loci in human cells. Science. 355, 7111 (2017).
- Hamperl, S., et al. Purification of specific chromatin domains from single-copy gene loci in Saccharomyces cerevisiae. Functional Analysis of DNA and Chromatin. 1094, 329-341 (2014).
- Hamperl, S., et al. Compositional and structural analysis of selected chromosomal domains from Saccharomyces cerevisiae. Nucleic Acids Research. 42 (1), 2 (2014).
- Weiβ, M. Single-copy locus proteomics of early- and late-firing DNA replication origins identifies a role of Ask1/DASH complex in replication timing control. Cell Reports. 42 (2), 112045 (2023).
- Gietz, R. D., Schiestl, R. H. High-efficiency yeast transformation using the LiAc/SS carrier DNA/PEG method. Nature Protocols. 2 (1), 31-34 (2007).
- Laemmli, U. K. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature. 227 (5259), 680-685 (1970).
- Towbin, H., Staehelin, T., Gordon, J. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proceedings of the National Academy of Sciences of the United States of America. 76 (9), 4350-4354 (1979).
- Western blot membrane stripping for restaining protocol. Abcam Available from: https://www.abcam.com/protocols/western-blot-membrane-stripping-for-restaining-protocol (2023)
- Vermeulen, M., Déjardin, J. Locus-specific chromatin isolation. Nature Reviews. Molecular Cell Biology. 21 (5), 249-250 (2020).
