미토콘드리아 DNA 합성 및 분포의 고처리량 이미지 기반 정량화
Summary
mtDNA 합성 및 분포를 검출하고 정량화하기 위해 다중 웰 플레이트 형식 및 자동화된 면역형광 이미징을 사용하여 세포에서 미토콘드리아 DNA(mtDNA) 대사의 역학을 연구하는 절차가 설명되어 있습니다. 이것은 mtDNA 대사에 대한 다양한 억제제, 세포 스트레스 및 유전자 침묵의 효과를 조사하는 데 추가로 사용될 수 있습니다.
Abstract
대부분의 세포 과정에는 지속적인 에너지 공급이 필요하며, 가장 일반적인 운반체는 ATP 분자입니다. 진핵 세포는 산화적 인산화에 의해 미토콘드리아에서 대부분의 ATP를 생산합니다. 미토콘드리아는 복제되어 차세대 세포로 전달되는 자체 게놈을 가지고 있기 때문에 독특한 세포 소기관입니다. 핵 게놈과 달리 세포에는 미토콘드리아 게놈의 여러 사본이 있습니다. 미토콘드리아 게놈의 복제, 복구 및 유지를 담당하는 메커니즘에 대한 자세한 연구는 정상 및 질병 조건 모두에서 미토콘드리아와 전체 세포의 적절한 기능을 이해하는 데 필수적입니다. 여기서, 시험관 내에서 배양된 인간 세포에서 미토콘드리아 DNA(mtDNA)의 합성 및 분포를 고처리량 정량화할 수 있는 방법이 제시된다. 이 접근법은 5-브로모-2′-데옥시유리딘(BrdU) 혼입으로 표지된 능동적으로 합성된 DNA 분자의 면역형광 검출과 항-DNA 항체가 있는 모든 mtDNA 분자의 동시 검출을 기반으로 합니다. 또한 미토콘드리아는 특정 염료 또는 항체로 시각화됩니다. 다중 웰 형식의 세포 배양과 자동 형광 현미경의 활용을 통해 비교적 짧은 시간에 다양한 실험 조건에서 mtDNA의 역학과 미토콘드리아의 형태를 더 쉽게 연구할 수 있습니다.
Introduction
대부분의 진핵 세포에서 미토콘드리아는 수많은 세포 과정에서 중요한 역할을 하기 때문에 필수 세포 기관입니다. 무엇보다도, 미토콘드리아는 세포의 핵심 에너지 공급원이다1. 미토콘드리아는 또한 세포 항상성(예: 세포 내 산화환원2 및 칼슘 균형3), 세포 신호 전달4,5, 세포자멸사6, 다른 생화학적 화합물의 합성 7,8 및 선천성 면역 반응9 조절에 관여합니다. 미토콘드리아 기능 장애는 다양한 병리학 적 상태 및 인간 질병과 관련이 있습니다10.
미토콘드리아의 기능은 핵 게놈과 미토콘드리아 게놈이라는 두 개의 개별 게놈에 위치한 유전 정보에 달려 있습니다. 미토콘드리아 게놈은 핵 게놈에 비해 적은 수의 유전자를 암호화하지만 모든 mtDNA 암호화 유전자는 인간의 생명에 필수적입니다. mtDNA를 유지하는 데 필요한 미토콘드리아 단백질 기계는 nDNA에 의해 암호화됩니다. 미토콘드리아 반응체의 기본 구성 요소와 일부 미토콘드리아 생물 발생 인자는 이미 확인되었습니다(이전 연구11,12에서 검토됨). 그러나 미토콘드리아 DNA 복제 및 유지 메커니즘은 아직 이해되지 않았습니다. nDNA와 달리, 미토콘드리아 게놈은 다중 사본으로 존재하며, 이는 미토콘드리아 유전자 발현을 조절하기 위한 추가 층을 제공합니다. 세포 기관 내에서 mtDNA의 분포와 분리, 이러한 과정이 어느 정도 조절되는지, 그리고 그렇다면 어떤 단백질이 관련되어 있는지에 대해서는 현재 알려진 바가 훨씬 적습니다13. 분리 패턴은 세포가 야생형 및 돌연변이 mtDNA의 혼합 집단을 포함할 때 중요합니다. 이들의 불균등한 분포는 유해한 양의 돌연변이된 mtDNA를 가진 세포의 생성으로 이어질 수 있습니다.
지금까지 mtDNA 유지에 필요한 단백질 인자는 주로 생화학적 방법, 생물정보학적 분석 또는 질병 관련 연구를 통해 확인되었습니다. 이 작업에서는 이전에 식별을 벗어난 요인을 식별할 수 있는 높은 기회를 보장하기 위해 다른 전략이 설명됩니다. 이 방법은 티미딘의 뉴클레오시드 유사체인 5-브로모-2′-데옥시유리딘(BrdU)으로 복제 또는 복구하는 동안 mtDNA를 표지하는 것을 기반으로 합니다. BrdU는 DNA 합성 중에 초기 DNA 가닥에 쉽게 통합되며, 일반적으로 핵 DNA14의 복제를 모니터링하는 데 사용됩니다. 그러나 여기에서 개발된 절차는 항-BrdU 항체의 면역형광을 사용하여 mtDNA에 혼입된 BrdU를 검출하는 데 최적화되었습니다.
이 접근법은 시험관 내에서 배양된 인간 세포에서 mtDNA 합성 및 분포의 고처리량 정량화를 가능하게 합니다. 비교적 짧은 시간에 다양한 실험 조건에서 테스트를 수행하려면 고처리량 전략이 필요합니다. 따라서, 세포 배양을 위한 멀티웰 포맷 및 이미징을 위한 자동화된 형광 현미경을 활용하는 것이 프로토콜에서 제안된다. 이 프로토콜에는 siRNA 라이브러리를 사용한 인간 HeLa 세포의 형질감염과 BrdU로 새로 합성된 DNA의 대사 표지를 사용한 mtDNA 복제 또는 복구의 후속 모니터링이 포함됩니다. 이 접근법은 항 DNA 항체의 도움으로 DNA의 면역 염색과 결합됩니다. 두 매개변수 모두 정량적 형광 현미경을 사용하여 분석됩니다. 또한 미토콘드리아는 특정 염료로 시각화됩니다. 프로토콜의 특이성을 입증하기 위해 BrdU 염색을 mtDNA가 없는 세포(rho0 세포), 잘 알려진 mtDNA 유지 인자의 침묵 시 HeLa 세포 및 mtDNA 복제 억제제로 처리한 후 HeLa 세포에서 테스트했습니다. mtDNA 수준은 또한 독립적인 방법, 즉 qPCR에 의해 측정되었다.
Protocol
Representative Results
Discussion
역사적으로, BrdU 혼입 및 항체 검출에 의한 DNA 표지는 핵 DNA 복제 및 세포주기 연구에 사용되어왔다 14,27,28. 지금까지 BrdU 표지 DNA를 검출하기 위한 모든 프로토콜에는 에피토프 노출을 가능하게 하고 항체 침투를 촉진하기 위한 DNA 변성 단계(산성 또는 열) 또는 효소 분해(DNase 또는 proteinase)가 포함되었습니다. 이 프로토콜은 단…
Offenlegungen
The authors have nothing to disclose.
Acknowledgements
이 작업은 폴란드 국립 과학 센터(보조금/수상 번호: 2018/31/D/NZ2/03901)의 지원을 받았습니다.
Materials
| 2′,3′-Dideoxycytidine (ddC) | Sigma-Aldrich | D5782 | |
| 384 Well Cell Culture Microplates, black | Greiner Bio-One | #781946 | |
| 5-Bromo-2′-deoxyuridine (BrdU) | Sigma-Aldrich | B5002-1G | Dissolve BrdU powder in water to 20 mM stock solution and aliquot. Use 20 µM BrdU solution for labeling. |
| Adhesive sealing film | Nerbe Plus | 04-095-0060 | |
| Alexa Fluor 488 goat anti-mouse IgG1 secondary antibody | Thermo Fisher Scientific | A-21121 | |
| Alexa Fluor 555 goat anti-mouse IgM secondary antibody | Thermo Fisher Scientific | A-21426 | |
| BioTek 405 LS microplate washer | Agilent | ||
| Bovine Serum Albumin (BSA) | Sigma-Aldrich | A4503 | |
| Cell counting chamber Thoma | Heinz Herenz | REF:1080339 | |
| Dulbecco's Modified Eagle Medium (DMEM) | Cytiva | SH30243.01 | |
| Dulbecco's Modified Eagle Medium (DMEM) | Thermo Fisher Scientific | 41965-062 | |
| Fetal Bovine Serum (FBS) | Thermo Fisher Scientific | 10270-106 | |
| Formaldehyde solution | Sigma-Aldrich | F1635 | Formaldehyde is toxic; please read the safety data sheet carefully. |
| Hoechst 33342 | Thermo Fisher Scientific | H3570 | |
| IgG1 mouse monoclonal anti-BrdU (IIB5) primary antibody | Santa Cruz Biotechnology | sc-32323 | |
| IgM mouse monoclonal anti-DNA (AC-30-10) primary antibody | Progen | #61014 | |
| LightCycler 480 System | Roche | ||
| Lipofectamine RNAiMAX Transfection Reagent | Thermo Fisher Scientific | #13778150 | |
| MitoTracker Deep Red FM | Thermo Fisher Scientific | M22426 | Mitochondria tracking dye |
| Multidrop Combi Reagent Dispenser | Thermo Fisher Scientific | ||
| Opti-MEM | Thermo Fisher Scientific | 51985-042 | |
| Orca-R2 (C10600) CCD Camera | Hamamatsu | ||
| Penicillin-Streptomycin | Sigma-Aldrich | P0781-100ML | |
| Phosphate buffered saline (PBS) | Sigma-Aldrich | P4417-100TAB | |
| PowerUp SYBR Green Master Mix | Thermo Fisher Scientific | A25742 | |
| qPCR primer Fw B2M (reference) | CAGGTACTCCAAAGATTCAGG | ||
| qPCR primer Fw GPI (reference gene) | GACCTTTACTACCCAGGAGA | ||
| qPCR primer Fw MT-ND1 | TAGCAGAGACCAACCGAACC | ||
| qPCR primer Fw POLG | TGGAAGGCAGGCATGGTCAAACC | ||
| qPCR primer Fw TFAM | GATGAGTTCTGCCTGCTTTAT | ||
| qPCR primer Fw TWNK | GCCATGTGACACTGGTCATT | ||
| qPCR primer Rev B2M (reference) | GTCAACTTCAATGTCGGATGG | ||
| qPCR primer Rev GPI (reference gene) | AGTAGACAGGGCAACAAAGT | ||
| qPCR primer Rev MT-ND1 | ATGAAGAATAGGGCGAAGGG | ||
| qPCR primer Rev POLG | GGAGTCAGAACACCTGGCTTTGG | ||
| qPCR primer Rev TFAM | GGACTTCTGCCAGCATAATA | ||
| qPCR primer Rev TWNK | AACATTGTCTGCTTCCTGGC | ||
| ScanR microscope | Olympus | ||
| siRNA Ctrl | Dharmacon | D-001810-10-5 | |
| siRNA POLG | Invitrogen | POLGHSS108223 | |
| siRNA TFAM | Invitrogen | TFAMHSS144252 | |
| siRNA TWNK | Invitrogen | C10orf2HSS125597 | |
| Suction device | NeoLab | 2-9335 | Suction device for cell culture |
| Triton X-100 | Sigma-Aldrich | T9284-500ML | |
| Trypsin | Biowest | L0931-500 | |
| UPlanSApo 20x 0.75 NA objective | Olympus |
Referenzen
- Brown, G. C. Control of respiration and ATP synthesis in mammalian mitochondria and cells. The Biochemical Journal. 284, 1-13 (1992).
- Zhang, L., et al. Biochemical basis and metabolic interplay of redox regulation). Redox Biology. 26, 101284 (2019).
- Pizzo, P., Drago, I., Filadi, R., Pozzan, T. Mitochondrial Ca2+ homeostasis: Mechanism, role, and tissue specificities. Pflugers Archiv: European Journal of Physiology. 464 (1), 3-17 (2012).
- Shadel, G. S., Horvath, T. L. Mitochondrial ROS signaling in organismal homeostasis. Cell. 163 (3), 560-569 (2015).
- Martínez-Reyes, I., Chandel, N. S. Mitochondrial TCA cycle metabolites control physiology and disease. Nature Communications. 11 (1), 102 (2020).
- Galluzzi, L., Kepp, O., Trojel-Hansen, C., Kroemer, G. Mitochondrial control of cellular life, stress, and death. Circulation Research. 111 (9), 1198-1207 (2012).
- Rone, M. B., Fan, J., Papadopoulos, V. Cholesterol transport in steroid biosynthesis: role of protein-protein interactions and implications in disease states. Biochimica Et Biophysica Acta. 1791 (7), 646-658 (2009).
- Swenson, S. A., et al. From synthesis to utilization: The ins and outs of mitochondrial heme. Cells. 9 (3), 579 (2020).
- West, A. P., Shadel, G. S., Ghosh, S. Mitochondria in innate immune responses. Nature Reviews. Immunology. 11 (6), 389-402 (2011).
- Nunnari, J., Suomalainen, A. Mitochondria: In sickness and in health. Cell. 148 (6), 1145-1159 (2012).
- Pohjoismäki, J. L. O., Goffart, S. Of circles, forks and humanity: Topological organisation and replication of mammalian mitochondrial DNA. BioEssays. 33 (4), 290-299 (2011).
- Gustafsson, C. M., Falkenberg, M., Larsson, N. -. G. Maintenance and expression of mammalian mitochondrial DNA. Annual Review of Biochemistry. 85, 133-160 (2016).
- Nicholls, T. J., Gustafsson, C. M. Separating and segregating the human mitochondrial genome. Trends in Biochemical Sciences. 43 (11), 869-881 (2018).
- Gratzner, H. G. Monoclonal antibody to 5-bromo- and 5-iododeoxyuridine: A new reagent for detection of DNA replication. Science. 218 (4571), 474-475 (1982).
- Stirling, D. R., et al. CellProfiler 4: Improvements in speed, utility and usability. BMC Bioinformatics. 22 (1), 433 (2021).
- R Core Team. R: A Language and Environment for Statistical Computing. R Foundation for Statistical Computing. , (2021).
- . dplyr: A Grammar of Data Manipulation Available from: https://CRAN.R-project.org/package=dplyr (2021)
- . data.table: Extension of `data.frame Available from: https://CRAN.R-project.org/package=data.table (2020)
- . ggplot2: Elegant graphics for data analysis Available from: https://ggplot2.tidyverse.org (2016)
- . ggpubr: "ggplot2" based publication ready plots Available from: https://CRAN.R-project.org/package=ggpubr (2020)
- Hashiguchi, K., Zhang-Akiyama, Q. -. M. Establishment of human cell lines lacking mitochondrial DNA. Methods in Molecular Biology. 554, 383-391 (2009).
- Piechota, J., Szczesny, R., Wolanin, K., Chlebowski, A., Bartnik, E. Nuclear and mitochondrial genome responses in HeLa cells treated with inhibitors of mitochondrial DNA expression. Acta Biochimica Polonica. 53 (3), 485-495 (2006).
- Spelbrink, J. N., et al. Human mitochondrial DNA deletions associated with mutations in the gene encoding Twinkle, a phage T7 gene 4-like protein localized in mitochondria. Nature Genetics. 28 (3), 223-231 (2001).
- Campbell, C. T., Kolesar, J. E., Kaufman, B. A. Mitochondrial transcription factor A regulates mitochondrial transcription initiation, DNA packaging, and genome copy number. Biochimica et Biophysica Acta. 1819 (9-10), 921-929 (2012).
- Krasich, R., Copeland, W. C. DNA polymerases in the mitochondria: A critical review of the evidence. Frontiers in Bioscience. 22 (4), 692-709 (2017).
- Kotrys, A. V., et al. Quantitative proteomics revealed C6orf203/MTRES1 as a factor preventing stress-induced transcription deficiency in human mitochondria. Nucleic Acids Research. 47 (14), 7502-7517 (2019).
- Gratzner, H. G., Pollack, A., Ingram, D. J., Leif, R. C. Deoxyribonucleic acid replication in single cells and chromosomes by immunologic techniques. Journal of Histochemistry & Cytochemistry. 24 (1), 34-39 (1976).
- Leif, R. C., Stein, J. H., Zucker, R. M. A short history of the initial application of anti-5-BrdU to the detection and measurement of S phase. Cytometry. Part A: The Journal of the International Society for Analytical Cytology. 58 (1), 45-52 (2004).
- Lentz, S. I., et al. Mitochondrial DNA (mtDNA) biogenesis: visualization and duel incorporation of BrdU and EdU into newly synthesized mtDNA in vitro. The Journal of Histochemistry and Cytochemistry. 58 (2), 207-218 (2010).
- Liu, Y., et al. Multi-omic measurements of heterogeneity in HeLa cells across laboratories. Nature Biotechnology. 37 (3), 314-322 (2019).
