היכרות גנטית הסתרה ישירות לתוך השלב Amastigote של טריאנוסומה cruzi באמצעות מערכת CRISPR/Cas9
Summary
כאן, אנו מתארים פרוטוקול להחדיר נוקאאוט גן לתוך amastigote החילוץ של טריאנוסומה cruzi, באמצעות מערכת CRISPR/Cas9. פנוטיפ הצמיחה ניתן לעקוב גם על ידי ספירת התאים של התרבות האמסטימית axenic או על ידי התפשטות amastigote תאיים לאחר הפלישה התא מארח.
Abstract
טריאנוסומה cruzi היא מחלת פתוזוזה טפיל הגורם המחלה של חגיאס בעיקר באמריקה הלטינית. כדי לזהות מטרה התרופה הרומן נגד T. cruzi, חשוב לאמת את החומריות של הגן היעד בשלב היונקים של הטפיל, amastigote. Amastigotes של T. cruzi לשכפל בתוך התא המארח; לפיכך, קשה לבצע ניסוי מנוקאאוט מבלי לעבור בשלבים התפתחותיים אחרים. לאחרונה, הקבוצה שלנו דיווחה על מצב גדילה שבו amastigote יכול לשכפל באופן מאקסיבי עד 10 ימים מבלי לאבד מאפיינים כמו amastigote שלה. באמצעות התרבות הרקתית הטמפורלית הזאת, הצגנו בהצלחה gRNAs ישירות לתוך Cas9 ביטוי amastigote כדי לגרום הסתרה גנים וניתח פנוטיפים שלהם באופן בלעדי בשלב amastigote. בדוח זה, אנו מתארים פרוטוקול מפורט כדי לייצר בעלי מיסוי מתורבת, amastigotes הנגזרים, ולהשתמש בתרבות axenic ב-CRISPR/Cas9-מתווך ניסוי הסתרה. פנוטיפ הצמיחה של בנוקאאוט amastigotes יכול להיות מוערך גם על ידי ספירות התא של התרבות axenic, או על ידי השכפול של amastigotes תאיים לאחר הפלישה תא מארח. שיטה זו עוקפת את השלב הטפיל בידול בדרך כלל מעורב בהפקת הטרנסגניים או amastigote נוק. הניצול של התרבות הרקתית הטמפורלית יש את הפוטנציאל להרחיב את החופש הניסיוני של מחקרים ספציפיים לבמה ב -T. cruzi.
Introduction
טריאנוסומה cruzi הוא הסוכן סיבתי של מחלת חגיאס, אשר נפוצה בעיקר באמריקה הלטינית1. T. cruzi יש שלבים מחזור החיים הייחודיים כפי שהוא נע בין וקטור חרק מארח יונקים2. T. cruzi משכפל כמו epimastigote ב באמצע המעיים של חרק triatomine דם מוצץ ומבדיל לתוך המעי הקדמי זיהומיות טריאואסטיגוטה בבטן לפני שהופקדו על מארח אדם או בעלי חיים. ברגע שטריאומואסטיט נכנס לגוף המארח דרך אתר העקיצה או דרך קרום רירי, הטפיל פולש לתא מארח והופך לצורה עגולה פחות שנקראת amastigote. ה-amastigote משכפל בתא המארח ובסופו של דבר מבדיל לטרימטואסטיגוטה, הפורץ מתוך התא המארח ונכנס לזרם הדם כדי להדביק תא מארח נוסף.
מאז הזמינים כיום סוכני כימותרפיה, בנזיל ו nifurטימופייביץ ‘, לגרום תופעות לוואי שליליות אינן יעילות בשלב כרונית של המחלה3, זה מעניין מאוד לזהות מטרות התרופה הרומן נגד T. cruzi. בשנים האחרונות, מערכת CRISPR/Cas9 הפכה כלי רב עוצמה כדי לבצע ביעילות בנוקאאוט גנים ב T. cruzi, או על ידי התפתחות של נפרד או בודד פלמיד (s) המכיל grna ו Cas94, על ידי ביטוי יציב של Cas9 ואחריו מבוא של grna5,6,7 או שעתוק תבנית של grna8, או על ידי אלקטרופורציה של הוקמה מראש grna/Cas9 rnp קומפלקס7,9. התקדמות טכנולוגית זו צפויה להאיץ את מחקר מטרות הסמים במחלת צ’אס.
כדי להמשיך בפיתוח התרופה, חיוני לאמת את החיוניות של הגן היעד או היעילות של תרכובות מועמדים לסמים ב-amastigote של T. cruzi, כפי שהוא שלב השכפול של הטפיל במארח היונקים. עם זאת, זוהי משימה מאתגרת, בגלל amastigotes לא ניתן לטפל ישירות בשל נוכחותם של תא מארח חסימתית. ב לישמניה, הקשורות באופן הדוק מאוד טפיל ל T. cruzi, השיטה האמסטימית amastigote שפותחה והיה מנוצל בסינון תרופות בחני10,11,12, 13. למרות שיש כמה אי-התאמות ברגישות לתרכובות בין האקסטיגוטים amastigotes ו תאיים מאוד14, היכולת לשמור על התרבות axenic בכל זאת מספק כלים ניסיוניים יקרי ערך ללמוד את ביולוגיה בסיסית של השלב הרלבנטי הקליני של לישמניה15,16. במקרה של T. cruzi, הספרות לגבי נוכחות של מוצרים באופן טבעי amastigotes (ea)17 ובייצור מחוץ לתחום של EA17,18,19 תאריך חזרה . לפני עשרות שנים בנוסף, EA ידוע יש יכולת מדבקת20, אם כי פחות מזה של טריאומואסטיגוטה, ואת המנגנון של הפלישה מארח amastigote כבר הובהר בשנים האחרונות (נבדקו על ידי bonfim-מלו אל.21). עם זאת, בניגוד לישמניה, EA לא היה מנוצל ככלי ניסיוני ב -T. cruzi, בעיקר בגלל EA היה נחשב כטפיל מחייב תאיים, ולכן לא נחשב בתור “הטופס replicative בצורה מעשית גיוני.
לאחרונה, הקבוצה שלנו הציע לנצל EA של T. cruzi כתרבות האקסון הזמני22. Amastigotes של T. cruzi tulahuen מאמץ יכול לשכפל חינם של תאים מארחים במדיום LIT ב 37 ° צ’ עד 10 ימים ללא הידרדרות מרכזית או אובדן של תכונות כמו amastigotes. במהלך תקופת הצמיחה המארחת ללא תשלום, EA היה מנוצל בהצלחה עבור ביטוי גנים אקסוסוגני על ידי electroporation קונבנציונאלי, התרופה טיטור שיטת עם תרכובות טרינורצח, ו CRISPR/Cas9-בתיווך הנוקאאוט ואחריו בניטור הצמיחה פנוטיפ. בדו ח זה, אנו מתארים את הפרוטוקול המפורט כדי לייצר ב-EA מחוץ למבחנה ולנצל את האמסטיגוטה האקסון בניסויי הנוקאאוט.
Protocol
Representative Results
Discussion
הדגמנו כי התרבות axenic של T. cruzi amastigotes יכול להיות מנוצל CRISPR/Cas9-תיווך גן בנוקאאוט, על ידי electroporating grna ישירות לתוך Cas9-המבטא EA. בדרך זו, החיוני של הגן היעד במיוחד בשלב amastigote ניתן להעריך מבלי לעבור בשלבים התפתחותיים אחרים.
עוד היבט מועיל של מעבר החצייה הוא הנוחות בבדיקות עבור מס?…
Offenlegungen
The authors have nothing to disclose.
Acknowledgements
עבודה זו נתמכת בחלקו על ידי JSPS KAKENHI גרנט מספר 18K15141 כדי חתיכה
Materials
| 20% formalin solution | FUJIFILM Wako Pure Chemical | 068-03863 | fixing cells |
| 25 cm2 double seal cap culture flask | AGC Techno Glass | 3100-025 | |
| 75 cm2 double seal cap culture flask | AGC Techno Glass | 3110-075 | |
| All-in One Fluorescence Microscope | Keyence | BZ-X710 | |
| Alt-R CRISPR-Cas9 crRNA (for Control) | IDT | custom made | target sequence = GGACGGCACCTTCATCTACAAGG |
| Alt-R CRISPR-Cas9 crRNA (for TcCGM1) | IDT | custom made | target sequence = TAGCCGCGATGGAGAGTTTATGG |
| Alt-R CRISPR-Cas9 crRNA (for TcPAR1) | IDT | custom made | target sequence = CGTGGAGAACGCCATTGCCACGG |
| Alt-R CRISPR-Cas9 tracrRNA | IDT | 1072532 | to anneal with crRNA |
| Amaxa Nucleofector device | LONZA | AAN-1001 | electroporation |
| Basic Parasite Nucleofector Kit 2 | LONZA | VMI-1021 | electroporation |
| BSA | Sigma-Aldrich | A3294 | component of the medium for in-vitro amastigogenesis |
| Burker-Turk disposable hemocytometer | Watson | 177-212C | cell counting |
| Coster 12-well Clear TC-Treated Multiple Well Plates | Corning | 3513 | |
| DMEM | FUJIFILM Wako Pure Chemical | 044-29765 | culture medium |
| Fetal bovine serum, Defined | Hyclone | SH30070.03 | heat-inactivate before use |
| G-418 Sulfate Solution | FUJIFILM Wako Pure Chemical | 077-06433 | selection of transformant |
| Hemin chloride | Sigma-Aldrich | H-5533 | component of LIT medium |
| Hoechst 33342 | Thermo Fisher Scientific | H3570 | staining of nuclei |
| Liver infusion broth, Difco | Becton Dickinson | 226920 | component of LIT medium |
| MES | FUJIFILM Wako Pure Chemical | 349-01623 | component of the medium for in-vitro amastigogenesis |
| PBS (–) | FUJIFILM Wako Pure Chemical | 166-23555 | |
| Propidium Iodide | Sigma-Aldrich | P4864-10ML | staining of dead cells |
| RPMI 1646 | Sigma-Aldrich | R8758 | medium for metacyclogenesis |
Referenzen
- World Health Organization. . (WHO) Fact sheet: Chagas disease (American trypanosomiasis). , (2017).
- Clayton, J. Chagas disease 101. Nature. 465 (n7301_supp), S4-S5 (2010).
- Apt, W. Current and developing therapeutic agents in the treatment of Chagas disease. Drug Design, Development and Therapy. 4, 243-253 (2010).
- Lander, N., Li, Z. H. H., Niyogi, S., Docampo, R. CRISPR/Cas9-induced disruption of paraflagellar rod protein 1 and 2 genes in Trypanosoma cruzi reveals their role in flagellar attachment. mBio. 6 (4), e01012 (2015).
- Peng, D., Kurup, S. P., Yao, P. Y., Minning, T. A., Tarleton, R. L. CRISPR-Cas9-mediated single-gene and gene family disruption in Trypanosoma cruzi. mBio. 6 (1), e02097-e02114 (2015).
- Romagnoli, B. A. A., Picchi, G. F. A., Hiraiwa, P. M., Borges, B. S., Alves, L. R., Goldenberg, S. Improvements in the CRISPR/Cas9 system for high efficiency gene disruption in Trypanosoma cruzi. Acta Tropica. 178, 190-195 (2018).
- Burle-Caldas, G. A., Soares-Simões, M., Lemos-Pechnicki, L., DaRocha, W. D., Teixeira, S. M. R. Assessment of two CRISPR-Cas9 genome editing protocols for rapid generation of Trypanosoma cruzi gene knockout mutants. International Journal for Parasitology. 48 (8), 591-596 (2018).
- Costa, F. C. Expanding the toolbox for Trypanosoma cruzi: A parasite line incorporating a bioluminescence-fluorescence dual reporter and streamlined CRISPR/Cas9 functionality for rapid in vivo localisation and phenotyping. PLoS Neglected Tropical Diseases. 12 (4), e0006388 (2018).
- Soares Medeiros, L. C. High-Efficiency Genome Editing in Protozoan Parasites Using CRISPR-Cas9 Ribonucleoproteins. mBio. 8 (6), (2017).
- Callahan, H. L., Portal, A. C., Devereaux, R., Grogl, M. An axenic amastigote system for drug screening. Antimicrobial Agents and Chemotherapy. 41 (4), 818-822 (1997).
- Bates, P. A. Axenic culture of Leishmania amastigotes. Parasitology Today. 9 (4), 143-146 (1993).
- Ravinder, R., Bhaskar, B., Gangwar, S., Goyal, N. Development of luciferase expressing Leishmania donovani axenic amastigotes as primary model for in vitro screening of antileishmanial compounds. Current Microbiology. 65 (6), 696-700 (2012).
- Nühs, A. Development and Validation of a Novel Leishmania donovani Screening Cascade for High-Throughput Screening Using a Novel Axenic Assay with High Predictivity of Leishmanicidal Intracellular Activity. PLoS Neglected Tropical Diseases. 9 (9), 1-17 (2015).
- De Rycker, M. Comparison of a high-throughput high-content intracellular Leishmania donovani assay with an axenic amastigote assay. Antimicrobial Agents and Chemotherapy. 57 (7), 2913-2922 (2013).
- Rochette, A., Raymond, F., Corbeil, J., Ouellette, M., Papadopoulou, B. Whole-genome comparative RNA expression profiling of axenic and intracellular amastigote forms of Leishmania infantum. Molecular and Biochemical Parasitology. 165 (1), 32-47 (2009).
- Pescher, P., Blisnick, T., Bastin, P., Späth, G. F. Quantitative proteome profiling informs on phenotypic traits that adapt Leishmania donovani for axenic and intracellular proliferation. Cellular Microbiology. 13 (7), 978-991 (2011).
- Andrews, N. W., Hong, K. S. U., Robbins, E. S., Nussenzweig, V. Stage-specific surface antigens expressed during the morphogenesis of vertebrate forms of Trypanosoma cruzi. Experimental Parasitology. 64 (3), 474-484 (1987).
- Pan, S. C. Trypanosoma cruzi: intracellular stages grown in a cell-free medium at 37 C. Experimental Parasitology. 45 (2), 215-224 (1978).
- Tomlinson, S., Vandekerckhove, F., Frevert, U., Nussenzweig, V. The induction of Trypanosoma cruzi trypomastigote to amastigote transformation by low pH. Parasitology. 110 (05), 547 (1995).
- Ley, V., Andrews, N. W., Robbins, E. S., Nussenzweig, V. Amastigotes of Trypanosoma cruzi sustain an infective cycle in mammalian cells. Journal of Experimental Medicine. 168 (0022-1007 (Print)), 649-659 (1988).
- Bonfim-Melo, A., Ferreira, E. R., Florentino, P. T. V., Mortara, R. A. Amastigote Synapse: The Tricks of Trypanosoma cruzi Extracellular Amastigotes. Frontiers in Microbiology. 9, 1341 (2018).
- Takagi, Y., Akutsu, Y., Doi, M., Furukawa, K. Utilization of proliferable extracellular amastigotes for transient gene expression, drug sensitivity assay, and CRISPR/Cas9-mediated gene knockout in Trypanosoma cruzi. PLOS Neglected Tropical Diseases. 13 (1), e0007088 (2019).
- Fernandes, J. F., Castellani, O. Growth characteristics and chemical composition of Trypanosoma cruzi. Experimental Parasitology. 18 (2), 195-202 (1966).
- Oberholzer, M., Lopez, M. A., Ralston, K. S., Hill, K. L. Approaches for Functional Analysis of Flagellar Proteins in African Trypanosomes. Methods in Cell Biology. 93, 21-57 (2009).
- van den Hoff, M. J. B., Moorman, A. F. M., Lamers, W. H. Electroporation in ‘intracellular’ buffer increases cell survival. Nucleic Acids Research. 20 (11), 2902-2902 (1992).
- Pacheco-Lugo, L., Díaz-Olmos, Y., Sáenz-García, J., Probst, C. M., DaRocha, W. D. Effective gene delivery to Trypanosoma cruzi epimastigotes through nucleofection. Parasitology International. 66 (3), 236-239 (2017).
- Coughlin, B. C., Teixeira, S. M., Kirchhoff, L. V., Donelson, J. E. Amastin mRNA abundance in Trypanosoma cruzi is controlled by a 3’-untranslated region position-dependent cis-element and an untranslated region-binding protein. The Journal of Biological Chemistry. 275 (16), 12051-1260 (2000).
- Shaw, A. K., Kalem, M. C., Zimmer, S. L. Mitochondrial Gene Expression Is Responsive to Starvation Stress and Developmental Transition in Trypanosoma cruzi. mSphere. 1 (2), (2016).
- Chao, D., Dusanic, D. G. Comparative studies of the isolation of metacyclic trypomastigotes of Trypanosoma cruzi by DEAE ion exchange chromatography. Zhonghua Minguo wei sheng wu ji mian yi xue za zhi (Chinese Journal of Microbiology and Immunology). 17 (3), 146-152 (1984).
- Nogueira, N., Bianco, C., Cohn, Z. Studies on the selective lysis and purification of Trypanosoma cruzi. The Journal of Experimental Medicine. 142 (1), 224-229 (1975).
- Minning, T. A., Weatherly, D. B., Atwood, J., Orlando, R., Tarleton, R. L., Tarleton, R. L. The steady-state transcriptome of the four major life-cycle stages of Trypanosoma cruzi. BMC Genomics. 10, 370 (2009).
- Rico, E., Jeacock, L., Kovářová, J., Horn, D. Inducible high-efficiency CRISPR-Cas9-targeted gene editing and precision base editing in African trypanosomes. Scientific Reports. 8 (1), 7960 (2018).
- Fu, Y. High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nature Biotechnology. 31 (9), 822-826 (2013).
- Kim, S., Kim, D., Cho, S. W., Kim, J., Kim, J. S. Highly efficient RNA-guided genome editing in human cells via delivery of purified Cas9 ribonucleoproteins. Genome Research. 24 (6), 1012-1019 (2014).
- Chiurillo, M. A., Lander, N., Bertolini, M. S., Storey, M., Vercesi, A. E., Docampo, R. Different roles of mitochondrial calcium uniporter complex subunits in growth and infectivity of Trypanosoma cruzi. mBio. 8 (3), e00574-e00617 (2017).
