Chip-Based Digital PCR to Detect Rare Transcript Variants Using a Nanofluidic Chip
Published: May 31, 2023
Abstract
Source: Molinari, C., et al. Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR. J. Vis. Exp. (2018).
This video demonstrates chip-based digital PCR — a variation of the digital PCR technique that is useful in detecting rare transcript variants. The PCR reaction is partitioned into the chambers of a nanofluidic chip, each of which acts as an independent reaction. The detection of fluorescence signals from the chambers with amplified targets confirms the presence of rare transcript variants in the sample.
Protocol
All procedures involving human participants have been performed in compliance with the institutional, national, and international guidelines for human welfare and have been reviewed by the local institutional review board. NOTE: This procedure is specifically designed for the detection of a low number of cDNA molecules in human fresh-frozen tissues. The tissue sections have been cut on dry ice, while still frozen, from previously validated patient-derived gastric tumor or norm…
Offenlegungen
The authors have nothing to disclose.
Materials
| TRIazol Reagent | Thermo Fisher Scientific | 15596018 | |
| Glycogen 20 mg/ml | ROCHE | 10901393001 | |
| RNeasy MinElute Cleanup kit | QIAGEN | 74204 | |
| iScript cDNA Synthesis kit | BioRad | 1708891 | |
| QuantStudio 3D Digital PCR Master Mix v2 | Thermo Fisher Scientific | A26358 | |
| CDH1a IDT custom designed assay | Integrated DNA Technologies (IDT) | NA | F) GCTGCAGTTTCACTTTTAGTG (R) ACTTTGAATCGGGTGTCGAG (P)/FAM/CGGTCGACAAAGGACAGCCTATT/TAMRA/ [dPCR optimized assay concentrations: 900 nM (F), 900 nM (R), 250 nM (P)] |
| QuantStudio 3D Digital PCR 20K Chip Kit v2 | Thermo Fisher Scientific | A26316 | |
| Heraeus Biofuge Fresco | Thermo Scientific | 75002402 | |
| Thermocycler (Labcycler) | Sensoquest | 011-103 | |
| GeneAmp PCR System 9700 | Thermo Fisher Scientific | N805-0200 | |
| Dual Flat Block Sample Module | Thermo Fisher Scientific | 4425757 | |
| QuantStudio 3D Tilt Base for Dual Flat Block GeneAmp PCR System 9700 | Thermo Fisher Scientific | 4486414 | |
| QuantStudio 3D Digital PCR Chip Adapter Kit for Flat Block Thermal Cycler | Thermo Fisher Scientific | 4485513 | |
| QuantStudio 3D Digital PCR Chip Loader | Thermo Fisher Scientific | 4482592 | |
| QuantStudio 3D Digital PCR Instrument with power cord | Thermo Fisher Scientific | 4489084 |
Tags
Diesen Artikel zitieren
Chip-Based Digital PCR to Detect Rare Transcript Variants Using a Nanofluidic Chip. J. Vis. Exp. (Pending Publication), e21363, doi: (2023).