Here, we show the process of creating a cellular electric voltage reporter zebrafish line to visualize embryonic development, movement, and fish tumor cells in vivo.
Bioelectricity, endogenous electrical signaling mediated by ion channels and pumps located on the cell membrane, plays important roles in signaling processes of excitable neuronal and muscular cells and many other biological processes, such as embryonic developmental patterning. However, there is a need for in vivo electrical activity monitoring in vertebrate embryogenesis. The advances of genetically encoded fluorescent voltage indicators (GEVIs) have made it possible to provide a solution for this challenge. Here, we describe how to create a transgenic voltage indicator zebrafish using the established voltage indicator, ASAP1 (Accelerated Sensor of Action Potentials 1), as an example. The Tol2 kit and a ubiquitous zebrafish promoter, ubi, were chosen in this study. We also explain the processes of Gateway site-specific cloning, Tol2 transposon-based zebrafish transgenesis, and the imaging process for early-stage fish embryos and fish tumors using regular epifluorescent microscopes. Using this fish line, we found that there are cellular electric voltage changes during zebrafish embryogenesis, and fish larval movement. Furthermore, it was observed that in a few zebrafish malignant peripheral nerve sheath tumors, the tumor cells were generally polarized compared to the surrounding normal tissues.
Bioelectricity refers to endogenous electrical signaling mediated by ion channels and pumps located on the cell membrane1. Ionic exchanges across the cellular membrane, and the coupled electrical potential and current changes, are essential for signaling processes of excitable neuronal and muscular cells. In addition, bioelectricity and ion gradients have a variety of other important biological functions including energy storage, biosynthesis, and metabolite transportation. Bioelectrical signaling was also discovered as a regulator of embryonic pattern formation, such as body axes, the cell cycle, and cell differentiation1. Thus, it is critical for understanding many human congenital diseases that result from the mis-regulation of this type of signaling. Although patch clamp has been widely used for recording single cells, it is still far from ideal for the simultaneous monitoring of multiple cells during embryonic development in vivo. Furthermore, voltage sensitive small molecules are also not ideal for in vivo applications due to their specificities, sensitivities, and toxicities.
The creation of a variety of genetically encoded fluorescent voltage indicators (GEVIs) offers a new mechanism to overcome this issue, and allows for easy application to study embryonic development, even though they were originally intended for monitoring neural cells2,3. One of the currently available GEVIs is the Accelerated Sensor of Action Potentials 1 (ASAP1)4. It is composed of an extracellular loop of a voltage-sensing domain of voltage sensitive phosphatase and a circularly permuted green fluorescent protein. Therefore, ASAP1 allows visualization of cellular electric potential changes (polarization: bright green; depolarization: dark green). ASAP1 has 2 ms on-and-off kinetics, and can track subthreshold potential change4. Thus, this genetic tool allows for a new level of efficacy in real-time bioelectric monitoring in live cells. Further understanding of the roles of bioelectricity in embryonic development and many human diseases, such as cancer, will shed new light on the underlying mechanisms, which is critical for disease treatment and prevention.
Zebrafish have been proven a powerful animal model to study developmental biology and human diseases including cancer5,6. They share 70% orthologous genes with humans, and they have similar vertebrate biology7. Zebrafish provide relatively easy care, a large clutch size of eggs, tractable genetics, easy transgenesis, and transparent external embryonic development, which make them a superior system for in vivo imaging5,6. With a large source of mutant fish lines already present and a fully sequenced genome, zebrafish will provide a relatively unlimited range of scientific discovery.
To investigate the in vivo real-time electrical activity of cells, we take advantage of the zebrafish model system and ASAP1. In this paper, we describe how to incorporate the fluorescent voltage biosensor ASAP1 into the zebrafish genome using Tol2 transposon transgenesis, and visualize cellular electrical activity during embryonic development, fish larval movement, and in live tumor.
Although the cellular and tissue level electrical activities during embryonic development and human disease were discovered a long time ago, the in vivo dynamic electrical changes and their biological roles still remain largely unknown. One of the major challenges is to visualize and quantify the electrical changes. Patch clamp technology is a break-through for tracking single cells, but its application to vertebrate embryos is limited because they are composed of many cells. The current chemical voltage dyes ar…
The authors have nothing to disclose.
The research work reported in this publication was supported by the National Institute of General Medical Sciences of the National Institutes of Health under the Award Number R35GM124913, Purdue University PI4D incentive program, and PVM Internal Competitive Basic Research Funds Program. The content is solely the responsibility of the authors and does not necessarily represent the official views of the funding agents. We thank Koichi Kawakami for the Tol2 construct, Michael Lin for the ASAP1 construct, and Leonard Zon for the ubi promoter construct through Addgene.
14mL cell culture tubes | VWR | 60818-725 | E.Coli culture |
Agarose electrophoresis tank | Thermo Scientific | Owl B2 | DNA eletrophoresis |
Agarose RA | Amresco | N605-500G | For making the injection gels |
Attb1-ASAP1-F primer | IDT DNA | GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACCATGGAGACGACTGTGAGGTATGAACA | ASAP1 coding region amplification for subcloning |
Attb2-ASAP1-R primer | IDT DNA | GGGGACCACTTTGTACAAGAAAGCTGGGTCTTAGGTTACCACTTCAAGTTGTTTCTTCTGTGAAGCCA | ASAP1 coding region amplification for subcloning |
Bright field dissection scope | Nikon | SMZ 745 | Dechorionation, microinjection, mounting |
Color camera | Zeiss | AxioCam MRc | Fish embryo image recording |
Concave slide | VWR | 48336-001 | For holding fish embryos during imaging process |
Disposable transfer pipette 3.4 ml | Thermo Scientific | 13-711-9AM | Fish embryos and water transfer |
Endonuclease enzyme, Not I | NEB | R0189L | For linearizing plasmid DNA |
Epifuorescent compound scope | Zeiss | Axio Imager.A2 | Fish embryo imaging |
Epifuorescent stereo dissection scope | Zeiss | Stereo Discovery.V12 | Fish embryo imaging |
Fluorescent light source | Lumen dynamics | X-cite seris 120 | Light source for fluorescence microscopes |
Forceps #5 | WPI | 500342 | Dechorionation and needle breaking |
Gateway BP Clonase II Enzyme mix | Thermo Scientific | 11789020 | Gateway BP recombination cloning |
Gateway LR Clonase II Plus enzyme | Thermo Scientific | 12538120 | Gateway LR recombination cloning |
Gel DNA Recovery Kit | Zymo Research | D4002 | DNA gel purification |
Loading tip | Eppendorf | 930001007 | For loading injection solution into capilary needles |
Methylcellulose (1600cPs) | Alfa Aesar | 43146 | Fish embryo mounting |
Methylene blue | Sigma-Aldrich | M9140 | Suppresses fungal outbreaks in Petri dishes |
Microinjection mold | Adaptive Science Tools | TU-1 | To prepare agaorse mold tray for holding fish embryos during injection |
Microinjector | WPI | Pneumatic Picopump PV820 | Microinjection injector |
Micro-manipulator | WPI | Microinjector mm33 rechts | Microinjection operation |
Micropipette puller | Sutter instrument | P-1000 | For preparing capillary needle |
Mineral oil | Amresco | J217-500ml | For calibrating injection volume |
mMESSAGE mMACHINE SP6 Transcription Kit | Thermo Scientific | AM1340 | mRNA in vitro transcription |
Monocolor camera | Zeiss | AxioCam MRm | Fish embryo image recording |
Plasmid Miniprep Kit | Zymo Research | D4020 | Prepare small amount of plasmid DNA |
Plastic Petri dishes | VWR | 25384-088 | For holding fish or fish embryos during imaging process |
RNA Clean & Concentrator-5 | Zymo Research | R1015 | mRNA cleaning after in vitro transcription |
Spectrophotometer | Thermo Scientific | NanoDrop 2000 | For measuring DNA and RNA concentrations |
Stage Micrometer | Am Scope | MR100 | Microinjection volume calibration |
Thermocycler | Bio-Rad | T100 | DNA amplification for gene cloning |
Thin wall glass capillaries | WPI | TW100F-4 | Raw glass for making cappilary needle |
Tol2-exL1 primer | IDT DNA | GCACAACACCAGAAATGCCCTC | Tol2 excise assay |
Tol2-exR primer | IDT DNA | ACCCTCACTAAAGGGAACAAAAG | Tol2 excise assay |
TOP10 Chemically Competent E. coli | Thermo Scientific | C404006 | Used for transformation during gene cloning |
Tricaine mesylate | Sigma-Aldrich | A5040 | For anesthetizing fish or fish embryos |
UV trans-illuminator 302nm | UVP | M-20V | DNA visualization |
Water bath | Thermo Scientific | 2853 | For transformation process of gene cloning |