אנו מדווחים על שני פרוטוקולים של סינכרון תאים המספקים הקשר ללימוד אירועים הקשורים לשלבים ספציפיים של מחזור התא. אנו מראים כי גישה זו שימושית לניתוח הרגולציה של גנים ספציפיים במחזור תאים לא מופרע או בחשיפה לסוכנים המשפיעים על מחזור התא.
התוכנית ביטוי גנים של מחזור התא מייצג צעד קריטי להבנת התהליכים תלוי מחזור התא ואת תפקידם במחלות כגון סרטן. התא מחזור מוסדר ניתוח ביטוי גנים תלוי בסנכרון התא לשלבים ספציפיים. כאן אנו מתארים שיטה ניצול שני פרוטוקולים סינכרון משלימים כי הוא נפוץ בחקר וריאציה תקופתית של ביטוי גנים במהלך מחזור התא. שני ההליכים מבוססים על חסימה זמנית של מחזור התא בנקודה אחת מוגדרת. פרוטוקול הסינכרון על ידי הידרוקסיאורה (HU) מוביל לתא סלולרי בסוף שלב G1 / מוקדם S, ושחרור ממעצר HU מתווך מספק אוכלוסייה סלולרית מתקדם באופן אחיד באמצעות S ו- G2 / M. פרוטוקול הסינכרון על-ידי טיפול ב- thymidine ו- nocodazole (Thy-Noc) חוסם תאים במיטוזה מוקדמת, ושחרור ממעצר Thy-Noc בתיווך מספק אוכלוסיה סלולרית מסונכרנת המתאימה לשלב G1 ו- S שלבEvacpid יישום של שני הליכים דורש ניטור של פרופילי הפצה מחזור התא, אשר מבוצעת בדרך כלל לאחר propidium יודיד (PI) מכתים של התאים זרימת cytometry בתיווך ניתוח של תוכן ה- DNA. אנו מראים שהשימוש המשולב בשני פרוטוקולי סינכרון הוא גישה חזקה לבירור ברור של הפרוטוקולים התעתיקיים של גנים המווסתים באופן דיפרנציאלי במחזור התא ( כלומר E2F1 ו- E2F7), וכתוצאה מכך יש הבנה טובה יותר של תפקידם במחזור התא תהליכים. יתר על כן, אנו מראים כי גישה זו שימושית עבור מחקר של מנגנונים המבוססים על תרופות מבוססות תרופה ( כלומר, mitomycin C, סוכן antiancer), משום שהוא מאפשר להפלות גנים כי מגיבים סוכן genotoxic מאלה שהושפעו רק על ידי הפרעות מחזור התא שהוטל על ידי הסוכן.
המעבר דרך כל השלבים של מחזור התא הוא מצורף לתוכנית ביטוי הגן מוסדר היטב. זה מתואמת "לסירוגין" של שעתוק גנים ברחבי מחזור התא הוא האמין להיות תחת שליטה של מערכות תמלול מורכבות תעתיק, המסדיר לא רק את העיתוי, אלא גם את רמות ביטוי גנים. הדה-רגולציה של מרכיבי מחזורי התא העיקריים ידועה כתורמת להתפתחותן של מספר מחלות והיא סימן ההיכר המובהק של tumorigenesis 1 , 2 . ניתוחי גנום רחבי תמליל שבוצעו בתאי שמרים ותאי יונקים גילו שמספר רב של גנים מציגים דפוסי ביטוי גנטיים מחזוריים במחזור התא, דבר המצביע על כך שתנודות תעתיק במהלך מחזור התא משקפות את הדרישה הטמפורלית של מוצר גנטי נתון בשלב 3 , 4 , </suP> 5 .
משימה מרכזית בחקר מחזור גנים מוסדר במחזור גנים היא סינכרון של תאים לשלבים ספציפיים של מחזור התא. סינכרון תאים מסייע לפרש את ההתאמה של דפוס ביטוי גנטי לתא מסוים של מעבר מחזורי התא, והוא הוביל להבנה טובה יותר של הרגולציה והתפקוד של גנים רבים. סינכרון סלולרי חשוב גם לחקר מנגנון הפעולה של תרופות נגד סרטן, כמו סוכני כימותרפיה ידועים להשפיע הן ביטוי גנים כמו גם מחזור תאים קינטיקה 6 , 7 . עם זאת, לעתים קרובות קשה לקבוע אם הפרשי ביטוי גנים הנובעים מטיפול בסוכנים אלה הם תגובה ישירה לטיפול או שהם רק תוצאה של שינויים בפרופילי מחזור התא. כדי להבחין בין האפשרויות הללו, ביטוי גנים צריך להיות מנותח בתאים שהיו sYnchronized לפני תוספת של תרופה כימותרפית.
למעט כמה תאים ראשוניים כגון תאים לימפואידים מבודדים טרי, אשר מהווים אוכלוסיית תאים הומוגנית מסונכרן G0 8 -, במבחנה הוקמה שורות תאים לגדול באופן אסינכרוני בתרבות. תחת תנאי צמיחה רגילים, אלה אופניים אסינכרוני אופניים נמצאים בכל השלבים של מחזור התא אבל, מעדיפים G1 9 . לכן, הקשר זה אינו מספק תרחיש אופטימלי עבור ניתוח פונקציונלי או ביטוי גנים בשלב מחזור תא מסוים ( לדוגמה , G1, S וכו '). שורות תאים נצחיות שלא הוסבו ( כגון fibroblasts) ניתן לסנכרן עם מה שמכונה שיטות פיזיולוגיות 10 . שיטות אלה מבוססות על תכונות התא העיקרי שנשמר של תאים שאינם משנים, כגון עיכוב קשר עם תא ותלות גורם גדילה כדי להמשיך את רכיבה על אופניים. הֲסָרָהשל סרום בשילוב עם עיכוב מגע הופך תאים שאינם הופכים נעצרו ב G0 / G1. עם זאת, מסומן מחזור מחזור התא התקדמות לעתים קרובות דורש תת, אשר כרוך גם ניתוק מלאכותי של תאים מחדש ציפוי 10 . והכי חשוב, שיטה זו אינה מתאימה לסינכרון של שורות תאים שהשתנו, הרוב המכריע של שורות תאים מבוססות הנמצאות בשימוש, המאופיינות בחסרונם של עיכובים בצמיחת מגע בתא או בתגובה לנסיגת גורמי גדילה. לכן, ברור כי שיטות חלופיות נדרשים סינכרון תא יעיל בשלבים ספציפיים של מחזור התא. באופן כללי, שיטות הסינכרון הנפוצות ביותר מבוססות על עיכוב כימי זמני או פרמקולוגי של נקודה מוגדרת אחת של מחזור התא, בדרך כלל סינתזה של DNA או יצירת ציר מיטוטי. עיכוב של סינתזת דנ"א מסנכרן תאים על ידי מעצר אותם בסוף G1 או בשלב S מוקדם. זה יכול להיות achiEved על ידי הוספת תרכובות כגון mimosine, מעכב של ביוטוסיזה של נוקליאוטיד 11 , 12 , aphidicolin, מעכב של פולימרים 13 , 14 , hydroxyurea, מעכב של ribonucleotide רדוקטאז 15 , 16 או על ידי כמויות עודפות של תימידין 17 , 18 . מצד שני, מעכבי פילמור microtubule, כגון קולצ'יצין או nocodazole, מסוגלים לחסום היווצרות ציר מיטוטי המוביל סינכרון התא בשלב M מוקדם 19 , 20 , 21 .
בעבודה זו אנו מתארים שיטה המערבת שני פרוטוקולים סינכרון משלימים המבוססים על עיכוב כימי חולף ללימוד הביטוי של גנים מחזורי מוסדר מחזור התא ב mRNAרָמָה. שיטה זו היא בסיסית להגדרת תפקידם של גנים במחזור תאים בתהליכי מחזור תאים ספציפיים. יתר על כן, הוא מספק מסגרת כללית לחקר ההשפעה של טיפולים נגד סרטן כדי לזהות במדויק את הגנים המגיבים לתרופות ולמזער הפרעות שגויות הנגזרות מהפרעות בתהליכי מחזור התא שנוצרו על ידי תרופות אלו.
ניתוח גנים מווסתים עדינים המעורבים בתפקידים זמניים וספציפיים במחזור התא דורשים אוכלוסיית תאים אחידה. חוקרים רבים משתמשים באופן שגרתי בקווי תאים סרטניים ארוכי טווח למטרות אלו, ומספר שיטות פותחו כדי להשיג אוכלוסיות תאים סינכרוני (או סינכרוני), במטרה לצבור תאים רבים כ…
The authors have nothing to disclose.
אנו מודים לחברי Zubiaga ומעבדות Altmeyer לדיונים מועילים ולתמיכה טכנית. עבודה זו נתמכה על ידי מענקים מהמשרד הספרדי (SAF2015-67562-R, MINECO / FEDER, UE), ממשלת הבאסקים (IT634-13 ו KK-2015/89), ואת אוניברסיטת המדינה הבסקית UPV / EHU ( UFI11 / 20).
DMEM, high glucose, GutaMAX supplement | Thermo Fisher Scientific | 61965-059 | |
FBS, qualified, E.U.-approved, South America origin | Thermo Fisher Scientific | 10270-106 | |
Penicillin-Streptomycin (10,000 U/mL) | Thermo Fisher Scientific | 15140-122 | |
0.25% Trypsin-EDTA (1X), phenol red | Thermo Fisher Scientific | 25200-072 | |
Thymidine | SIGMA | T1895-5G | Freshly prepared. Slight warming might help dissolve thymidine. |
Nocodazole | SIGMA | M-1404 | Stock solution in DMSO stored at -20 ºC in small aliquots |
Hydroxyurea | SIGMA | H8627 | Freshly prepared |
Mitomycin C from Streptomyces caespitosus | SIGMA | M4287 | 1.5mM stock solution in sterile H2O protected from light and stored at 4ºC |
Dimethyl sulfoxide | SIGMA | D2650 | |
Propidium iodide | SIGMA | P4170 | Stock solution in sterile PBS at 5 mg/ml, stored at 4º C protected from light. |
PBS pH 7.6 | Home made | ||
Ethanol | PANREAC | A3678,2500 | |
Chloroform | SIGMA | C2432 | |
Sodium Citrate | PANREAC | 131655 | |
Triton X-100 | SIGMA | T8787 | |
RNAse A | Thermo Fisher Scientific | EN0531 | |
TRIzol Reagent | LifeTechnologies | 15596018 | |
RNeasy Mini kit | QIAGEN | 74106 | |
High-Capacity cDNA Reverse Transcription Kit | Thermo Fisher Scientific | 4368814 | |
Anti-Cyclin E1 antibody | Cell Signaling | 4129 | 1:1000 dilution in 5% milk, o/n, 4 ºC |
Anti-Cyclin B1 antibody | Cell Signaling | 4135 | 1:1000 dilution in 5% milk, o/n, 4 ºC |
Anti-β-actin | SIGMA | A-5441 | 1:3000 dilution in 5 % milk, 1 hr, RT |
Anti-pH3 (Ser 10) antiboty | Millipore | 06-570 | Specified in the protocol |
Secondary anti-rabbit AlexaFluor 488 antibody | Invitrogen | R37116 | Specified in the protocol |
Secondary anti-mouse-HRP antibody | Santa Cruz Biotechnology | sc-3697 | 1:3000 dilution in 5 % milk, 1 hr, RT |
Forward E2F1 antibody (human) TGACATCACCAACGTCCTTGA | Biolegio | Designed by PrimerQuest tool (https://eu.idtdna.com/site) | |
Reverse E2F1 antibody (human) CTGTGCGAGGTCCTGGGTC | Biolegio | Designed by PrimerQuest tool (https://eu.idtdna.com/site) | |
Forward E2F7 antibody (human) GGAAAGGCAACAGCAAACTCT | Biolegio | Designed by PrimerQuest tool (https://eu.idtdna.com/site) | |
Reverse E2F7 antibody (human) TGGGAGAGCACCAAGAGTAGAAGA | Biolegio | Designed by PrimerQuest tool (https://eu.idtdna.com/site) | |
Forward p21Cip1 antibody (human) AGCAGAGGAAGACCATGTGGAC | Biolegio | Designed by PrimerQuest tool (https://eu.idtdna.com/site) | |
Reverse p21Cip1 antibody (human) TTTCGACCCTGAGAGTCTCCAG | Biolegio | Designed by PrimerQuest tool (https://eu.idtdna.com/site) | |
Forward TBP antibody (human) reference gene | Biolegio | Designed by PrimerQuest tool (https://eu.idtdna.com/site) | |
Reverse TBP antibody (human) | Biolegio | Designed by PrimerQuest tool (https://eu.idtdna.com/site) | |
Forward Oxa1L antibody (human) reference gene CACTTGCCAGAGATCCAGAAG | Biolegio | Designed by PrimerQuest tool (https://eu.idtdna.com/site) | |
Reverse Oxa1L antibody (human) CACAGGGAGAATGAGAGGTTTATAG | Biolegio | Designed by PrimerQuest tool (https://eu.idtdna.com/site) | |
Power SYBRGreen PCR Master Mix | Thermo Fisher Scientific | 4368702 | |
FACS Tubes | Sarstedt | 551578 | |
MicroAmp Optical 96-Well Reaction Plate | Thermo Fisher Scientific | N8010560 | |
Corning 100mm TC-Treated Culture Dish | Corning | ||
Corning Costar cell culture plates 6 well | Corning | 3506 | |
Refrigerated Bench-Top Microcentrifuge | Eppendorf | 5415 R | |
Refrigerated Bench-Top Centrifuge Jouan CR3.12 | Jouan | 743205604 | |
NanoDrop Lite Spectrophotometer | Thermo Scientific | ND-LITE-PR | |
BD FACSCalibur Flow Cytometer | BD Bioscience | ||
QuantStudio 3 Real-Time PCR System | Thermo Fisher Scientific | A28567 |