Flow-sortering en Exome Sequencing van de Reed-Sternberg Cellen van Klassieke Hodgkin Lymfoom
Summary
Hier beschrijven we een gecombineerde flow cytometrische celsortering en een laag ingevoerde, volgende generatie bibliotheekconstructieprotocol dat is ontworpen om hoogwaardige, volledige exome data van de Hodgkin Reed-Sternberg (HRS) cellen van klassiek Hodgkin lymfoom (CHL) te produceren.
Abstract
De Hodgkin Reed-Sternberg cellen van klassiek Hodgkin lymfoom zijn gering verdeeld binnen een achtergrond van ontstekingslymfocyten en omvatten gewoonlijk minder dan 1% van de tumormassa. Materiaal afgeleid van bulk tumor bevat tumor inhoud bij een concentratie onvoldoende voor karakterisering. Daarom wordt de fluorescentie geactiveerde celsortering met behulp van acht antilichamen, evenals zij- en voorwaartse verspreiding hier beschreven als een methode om snel met duizend HRS-cellen uit de tumor voor de volgende studie snel te scheiden en te concentreren. Tegelijkertijd, omdat standaardprotocollen voor exome-sequencing meestal 100-1000 ng input-DNA nodig hebben, dat vaak te hoog is, ook bij het sorteren van vloeistoffen, bieden wij ook een geoptimaliseerd, lage invoer bibliotheekconstructieprotocol dat in staat is hoge kwaliteit te produceren Gegevens van zo weinig als 10 ng input DNA. Deze combinatie kan de volgende generatie bibliotheken produceren die geschikt zijn voor hybridisatie-opname van whole-eXome aasjes of meer gerichte gerichte panelen, zoals gewenst. Exome sequencing van de HRS-cellen, in vergelijking met gezonde T-cellen van T-cellen of B, kunnen somatische veranderingen identificeren, waaronder mutaties, invoegingen en deleties, en kopie-nummerveranderingen. Deze bevindingen verduidelijken de moleculaire biologie van HRS-cellen en kunnen routes voor gerichte geneesmiddelen behandelen.
Introduction
Bevorderingen in kankergenetica als gevolg van volgende generatie sequencing hebben geleid tot significante doorbraken bij de identificatie van therapeutische doelen en in prognosticatie voor veel hematologische en niet-hematologische neoplasma's. Nieuwe geïndividualiseerde behandelingsstrategieën op basis van specifieke genomische veranderingen worden snel ingevoerd in veel tumortypes (onderzocht in referenties 1 , 2 ). Ondanks de significante vooruitgang in de lymfoom genomics, was het genoom van de neoplastische HRS-cellen in klassiek Hodgkin lymfoom (CHL) onderzocht. De onderzoeken zijn belemmerd door de schaarste van neoplastische HRS-cellen binnen een reactieve microomgeving, waardoor het moeilijk is om gesuiverde HRS-celpopulaties te isoleren 3 .
De werkwijze voor het isoleren van levensvatbare HRS-cellen uit primaire tumoren werd ontwikkeld door Fromm et al. 4 ,Ref "> 5 , 6. De methode maakt gebruik van een acht-antilichaamcocktail, bestaande uit CD30, CD15, CD40, CD95, CD45 CD20, CD5 en CD64 om ondubbelzinnig HRS-cellen te identificeren uit een CHL tumor suspensie. Zijn in staat om ten minste 1000 levensvatbare HRS-cellen te isoleren uit verse of bevroren cel suspensies van tumorbiopsies bestaande uit ten minste 10 7 cellen (ongeveer 10 mg weefsel). De zuiverheid is meer dan 90% door middel van flowcytometrische analyse en wordt geschat op Minstens 80% door middel van exome genomische analyse van tien opeenvolgende gevallen.
We hebben een flow-cytometrische celisolatie techniek verfijnd die het proces aanzienlijk vergemakkelijkt, waardoor een snelle isolatie van duizenden levensvatbare HRS-cellen uit primaire CHL tumoren 7 mogelijk is . We hebben de techniek gebruikt om te produceren wat wordt aangenomen dat het de eerste hele exome sequentie van de tumorcellen is in primaire gevallen van Hodgkin lymfoom. Onze studies tonen aan datE haalbaarheid van high-throughput, genoom-brede studies van individuele CHL-gevallen en hebben al geleid tot de identificatie van nieuwe genomische veranderingen met het potentieel om aspecten van CHL pathogenese uit te leggen.
We hebben verder een pijpleiding ontwikkeld om het geëxtraheerde DNA te gebruiken voor genomische studies met hoge doorvoer. Om betrouwbare resultaten te verkrijgen van zo weinig als 1.000 gesorteerd HRS cellen (het minimum verkregen uit sequentiële gevallen), ontwikkelden we een gewijzigde volgende generatie DNA bibliotheek constructie procedure 8 die ons toestaat om de adapter ligatie efficiëntie te verhogen en DNA fragmenten bibliotheken te genereren Zonder overmatige amplificatie. Deze methode zorgt voor de analyse van routine klinische monsters en de detectie van herhalende mutaties en chromosomale veranderingen 7 .
Protocol
Representative Results
Discussion
Toekomstige toepassingen of aanwijzingen na het masteren van deze techniek
Dit werk laat exome sequencing toe van monsters die tenminste 10 ng DNA bevatten. In de klinische context sluit deze limiet de meeste fijne aspiratiemonsters weg van onvoldoende materiaal, maar bevat ook adequate kernbiopsies en excisie-biopsiemonsters. Dit zal de aanschaf van gegevens van een grotere reeks mogelijke monsters mogelijk maken.
Kritieke stappen binnen…
Disclosures
The authors have nothing to disclose.
Acknowledgements
De ontwikkeling van deze projectmethode is gefinancierd door de afdeling pathologie en laboratoriumgeneeskunde van Weill Cornell Medical College. Wij erkennen het Tri-institutionele Opleidingsprogramma in Computational Biology and Medicine voor gedeeltelijke financiering. Wij danken de wetenschappers die hun tijd en kennis met ons hebben gedeeld, vooral Maryke Appel; Dan Burgess; Iwanka Kozarewa; Chad Locklear; En iedereen van de Weill Cornell Medical College Genomics Core Facility, waaronder Jenny Zhang, Xiaobo (Shawn) Liang, Dong Xu, Wei Zhang, Huimin Shang, Tatiana Batson en Tuo Zhang.
Materials
| Petri or Cell Culture Dish (sterile) | |||
| RPMI-1640 Media | Roswell Park Memorial Institute | ||
| Fetal Calf Serum (FCS), (heat inactivated) | |||
| Freezing Media (RPMI, 20% FCS, 10% dimethylsulfoxide (DMSO))-make fresh and keep sterile | |||
| RPMI with 2% FCS (make fresh or store for up to 1 month) | |||
| scalpel with fresh blade | |||
| 10 ml syringe (no needle) | |||
| Cryogenic vials | |||
| 50 ml conical centrifuge tubes, force | |||
| Centrifuge | capable of handling 50 ml conical centrifuge tubes and providing 400g | ||
| Hepes buffer(1M, cell culture grade) | |||
| phosphate buffered saline (PBS) | |||
| Pluoronic-F68 | Thermo-Fisher | 24040-032 | |
| DNAase-I | Sigma-Aldrich, St. Louis, MO | D4527-10KU | store as 5mg/ml in RPMI in -200C |
| Bovine Serum Albumin (BSA) | |||
| Sort Media (PBS+2%BSA+25mM HEPES+ Pluoronic –F68 (1X)) | |||
| CD64-FITC (22) | Beckman Coulter, Miami, FL | 20 uL suggested starting volume; Titering is suggested | |
| CD30-PE (BerH83) | BD Biosciences, San Jose, CA | 20 uL suggested starting volume; Titering is suggested | |
| CD5-ECD (BL1a) | Beckman Coulter, Miami, FL | 10 uL suggested starting volume; Titering is suggested | |
| CD40-PerCP-eFluor 710 (1C10) | Ebiosciences, San Diego, CA | 5 uL suggested starting volume; Titering is suggested | |
| CD20-PC7 (B9E9) | Beckman Coulter, Miami, FL | 10 uL suggested starting volume; Titering is suggested | |
| CD15-APC (HI98) | BD Biosciences, San Jose, CA | 20 uL suggested starting volume; Titering is suggested | |
| CD45 APC-H7 (2D1) | BD Biosciences, San Jose, CA | Can be substituted with 10 uL suggested volume of CD45-Krome Orange (J.33, Beckman Coulter); Titering is suggested | |
| CD95-Pacific Blue (DX2) | Life Technologies, Grand Island, NY | 5 uL suggested starting volume; Titering is suggested | |
| CD2 (5 μg; clone RPA-2.10) | Biolegend, San Diego, CA | For optional protocol; Titering is suggested | |
| CD54 (10 μg; clone 84H10) | Serotec, Oxford, United Kingdom | For optional protocol; Titering is suggested | |
| CD58 (10 μg; clone TS2/9) | eBioscience, San Diego, CA | For optional protocol; Titering is suggested | |
| LFA-1 (12 μg; clone MHM23) | Novus Biologicals, Littleton, CO | For optional protocol; Titering is suggested | |
| BD CS&T Beads | BD Biosciences, San Jose, CA | ||
| BD Accudrop Beads | BD Biosciences, San Jose, CA | ||
| BC Versa Comp antibody capture beads | Beckman Coulter, Miami, FL | Compensation Beads | |
| BD-FACS ARIA special research order instrument using 5 lasers | BD Biosciences, San Jose, CA | any BD-FACS aria with capabilities to detect the fluorochromes in the antibody panel should be sufficient | |
| Wizard | Promega | A2360 | |
| 10 mM Tris-Cl buffer | NA | ||
| Qubit dsDNA HS Assay kit | Life Technologies, Carlsbad, CA | ||
| S2 Sonicator | Covaris, Woburn, MA | Alternatives may be substituted | |
| microTUBE | Covaris, Woburn, MA | ||
| Low-Throughput Library Preparation Kit | Kapa Biosystems, Wilmington, MA | KK8221 | |
| Sybr Green | Sigma-Aldrich, St. Louis, MO | S9430 | |
| Agencourt AMPure XP Beads | Beckman Coulter, Miami, FL | ||
| Bioanalyzer | Agilent Technologies, Santa Clara, CA | ||
| SeqCap EZ Exome v.3.0 | Roche Nimblegen | 6465684001 | |
| HiSeq | Illumina | ||
| TruSeq-style Universal adapter | Integrated DNA Technologies (IDT), Coralville, Iowa | HPLC purification; AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGAT*C*T | |
| TruSeq-style index adapter | Integrated DNA Technologies (IDT), Coralville, Iowa | HPLC purification; /5Phos/GATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG | |
| TruSeq-style PCR primer 1 | Integrated DNA Technologies (IDT), Coralville, Iowa | AATGATACGGCGACCACCGAGA | |
| TruSeq-style PCR primer 2 | Integrated DNA Technologies (IDT), Coralville, Iowa | CAAGCAGAAGACGGCATACGAG | |
| Nuclease Free Duplex Buffer | Integrated DNA Technologies (IDT), Coralville, Iowa | ||
| BD FACSDIVA software | BD Biosciences, San Jose, CA | ||
| BD Falcon Tubes | BD Biosciences, San Jose, CA | ||
| BD Flow Tubes | BD Biosciences, San Jose, CA | ||
References
- Abrams, J. National Cancer Institute’s Precision Medicine Initiatives for the new National Clinical Trials Network. American Society of Clinical Oncology educational book / ASCO. American Society of Clinical Oncology. Meeting. , 71-76 (2014).
- Gagan, J., Van Allen, E. M. Next-generation sequencing to guide cancer therapy. Genome medicine. 7, 80 (2015).
- Matsuki, E., Younes, A. Lymphomagenesis in Hodgkin lymphoma. Seminars in cancer biology. 34, 14-21 (2015).
- Fromm, J. R., Kussick, S. J., Wood, B. L. Identification and purification of classical Hodgkin cells from lymph nodes by flow cytometry and flow cytometric cell sorting. Am J Clin Pathol. 126 (5), 764-780 (2006).
- Fromm, J. R., Thomas, A., Wood, B. L. Flow cytometry can diagnose classical hodgkin lymphoma in lymph nodes with high sensitivity and specificity. Am J Clin Pathol. 131 (3), 322-332 (2009).
- Roshal, M., Wood, B. L., Fromm, J. R. Flow cytometric detection of the classical hodgkin lymphoma: clinical and research applications. Advances in hematology. 2011, 387034 (2011).
- Reichel, J., et al. Flow sorting and exome sequencing reveal the oncogenome of primary Hodgkin and Reed-Sternberg cells. Blood. 125 (7), 1061-1072 (2015).
- Kozarewa, I. A Modified Method for Whole Exome Resequencing from Minimal Amounts of Starting DNA. PLoS ONE. 7 (3), e32617 (2012).
- Brunicardi, F. C. . Schwartz’s Principles of Surgery. , (2014).
- Kantor, A. B., Roederer, M. FACS analysis of leukocytes. Handbook of Experimental Immunology. 2, (1996).
- Sanders, M. E. Molecular pathways of adhesion in spontaneous rosetting of T-lymphocytes to the Hodgkin’s cell line L428. Cancer Res. 48 (1), 37-40 (1988).
- Biosciences. . FACSAria II User’s Guide. Part No. 644832, Revision A. , (2009).
- . Qubit 3.0 Fluorometer, Catalog Number Q33216 Available from: https://www.thermofisher.com/order/catalog/product/Q33216 (2017)
- Roche Nimblegen. . SeqCap EZ Library SR User’s Guide ver. 4.1. , (2013).
- Li, H., Durbin, R. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics. 25 (14), 1754-1760 (2009).
- Li, H. The Sequence Alignment/Map format and SAMtools. Bioinformatics. 25 (16), 2078-2079 (2009).
- Saunders, C. T. Strelka: accurate somatic small-variant calling from sequenced tumor-normal sample pairs. Bioinformatics. 28 (14), 1811-1817 (2012).
- Cingolani, P., et al. A program for annotating and predicting the effects of single nucleotide polymorphisms, SnpEff: SNPs in the genome of Drosophila melanogaster strain w1118; iso-2; iso-3. Fly (Austin). 6 (2), 80-92 (2012).
- Dobin, A. STAR: ultrafast universal RNA-seq aligner. Bioinformatics. 29 (1), 15-21 (2013).
- Thorvaldsdottir, H., Robinson, J. T., Mesirov, J. P. Integrative Genomics Viewer (IGV): high-performance genomics data visualization and exploration. Briefings in bioinformatics. 14 (2), 178-192 (2013).
- . DNA copy number data analysis. v.R package version 1.34.0 Available from: https://omictools.com/dnacopy-tool (2013)
