<em>CcCIPK14</em> Gene Function Analysis to Illuminate the Efficient Root Transgenic System

Tengyue Liu; Zhihua Song; Tingting Du; Wanlong Yang; Ting Chen; Ying Han; Biying Dong; Hongyan Cao; Lili Niu; Rohul Amin; Haojie jin; Qing Yang; Dong Meng; Yujie Fu

doi:10.3791/62304

JoVE Journal > Genetics

Genetics

CcCIPK14 Gene Function Analysis to Illuminate the Efficient Root Transgenic System

Published: September 23, 2021

doi:

10.3791/62304

Tengyue Liu*¹, Zhihua Song*¹, Tingting Du¹, Wanlong Yang¹, Ting Chen¹, Ying Han¹, Biying Dong¹, Hongyan Cao¹, Lili Niu^1,2, Rohul Amin¹, Haojie jin¹, Qing Yang^1,2, Dong Meng^1,2, Yujie Fu^1,2

¹College of Forestry,Beijing Forestry University, ²Beijing Advanced Innovation Center for Tree Breeding by Molecular Design,Beijing Forestry University

Summary

Here we present an efficient and stable transformation system for the functional analysis of the CcCIPK14 gene as an example, providing a technical basis for studying the metabolism of non-model plants.

Abstract

An efficient and stable transformation system is fundamental for gene function study and molecular breeding of plants. Here, we describe the use of an Agrobacterium rhizogenes mediated transformation system on pigeon pea. The stem is infected with A. rhizogenes carrying a binary vector, which induced callus after 7 days and adventitious roots 14 days later. The generated transgenic hairy root was identified by morphological analysis and a GFP reporter gene.To further illustrate the application range of this system, CcCIPK14 (Calcineurin B-like protein-interacting protein kinases) was transformed into pigeon pea using this transformation method. The transgenic plants were treated with jasmonic acid (JA) and abscisic acid (ABA), respectively, for the purpose of testing whether CcCIPK14 responds to those hormones. The results demonstrated that (1) exogenous hormones could significantly upregulate the expression levelof CcCIPK14, especially in CcCIPK14 over-expression (OE) plants; (2) the content of Genistein in CcCIPK14-OE lines was significantly higher than the control; (3) the expression level of two downstream key flavonoid synthase genes, CcHIDH1 and CcHIDH2, were up-regulated in the CcCIPK14-OE lines; and (4) the hairy root transgenic system can be used to study metabolically functional genes in non-model plants.

Introduction

Transformation is a basic tool to evaluate the expression of exogenous genes¹^,². Many biological aspects of resource plants are common to all plants; therefore, functional studies of certain genes canbe carried out in model plants (such as Arabidopsis)³. Yet, many genes in plants are unique in their function and expression patterns, requiring studies in their own or closely related species, especially for resource plants³^,⁴. Plant cells can sense various signals that enable plants to show specific changes in gene expression, metabolism, and physiology in response to different environmental stress conditions⁵^,⁶^,⁷. Flavonoids are crucial players in the signaling process of plants that is responsive to environmental stresses⁵^,⁸^,⁹. In addition, the flavonoid content in horticultural and medicinal plants is also an important indicator for quality evaluation¹⁰. Identification of genes involved in the regulation of flavonoid synthesis in response to external signals is crucial for understanding the mechanism of flavonoid synthesis in plants. Several studies have revealed that the application of exogenous hormones can promote the accumulation of flavonoids⁶^,¹¹. A stable transformation system and gene function validation method are essential to demonstrate the function of genes and to understand secondary metabolism in plants.

Agrobacterium-mediated transformation is widely used in DNA insertion⁵^,⁸^,⁹. Agrobacterium tumefacient can transfer ring genes into the chromosomes of plant cells, and exogenous phytohormones induce single or a few host cells that can regenerate plants to obtain stable transformants¹²^,¹³^,¹⁴. Agrobacterium tumefacient-mediated transformation methods are more applicable to plant species suitable for in vitro manipulation, while most perennial woody plants limit the application of this method because of their regeneration difficulty⁴^,¹⁵. A. rhizogenes is also able to modify the genome of host cells¹⁶. In the present study, we have developed an efficient and stable A. rhizogenes-mediated transformation procedure. A. rhizogenes contains a second binary plasmid carrying non-natural gene T-DNA in addition to the Ri plasmid. The host plant is infected, and a composite plant can be obtained with transgenic hairy roots emerging from the wild-type shoot¹⁶^,¹⁷. The A. rhizogenes-mediated transformation systems are suitable for application in woody plant research due to their fast, low cost and non-required plant regeneration. More than 160 kindsof plants have successfully induced hairy roots, and most of which are in Solanaceae, Compositae, Cruciferae, Convolvulaceae, Umbelliferae, Leguminosae, Caryophyllaceae, and Polygonaceae¹⁸^,¹⁹. Compared with A. tumefaciens, A. rhizogenes showed higher efficiency in the mediated transformation of pigeon pea¹⁷^,²⁰.

In this study, pigeon pea was used as an example to introduce the transformation process mediated by A. rhizogenes. From inoculation to rooting, the experiments lasted for 5 weeks. We identified the transformation of the adventitious root through morphology and the GFP reporter gene, and the transformation efficiency was as high as 75%. Also, we treated the composite plant with JA and ABA, as well as detected transcripts and secondary metabolites by quantitative real-PCR and HPLC (high performance liquid chromatography). It is confirmed that the expression level of CcCIPK14 responds not only to JA and ABA but also affects the biosynthesis of flavonoids. This system is adequate for studying function genes associated with secondary metabolism. It also provides a new approach to studying non-model plants in lack of a sufficient stable transformation system¹⁷^,²¹^,²².

Protocol

NOTE: Pigeon pea is a diploid legume crop that belongs to the family Fabaceae. The pigeon pea seeds used in this experiment are from the Northeast Forestry University of China and are coded 87119. The primary steps of this protocol are illustrated in Figure 1A. The seedling incubation was performed in a high humidity environment at 25 °C under fluorescent lights at 50 µmol photons per m^-2s^-1 in a 16 h photoperiod. A. rhizogenes strains K599 (NCPPB2659) were preserved in the laboratory. They were stored in yeast mannitol medium (YEP) with 15% glycerol at -80 °C. The protocol described in this work was based on the protocol Meng et al.²¹.

CAUTION: Deposit all the genetically modified bacteria and plants into the appropriate waste container. Use all hazardous chemicals in a fume hood and dispose of them in the hazardous waste container.

1. Preparation of pigeon pea seedlings

Choose plump and undamaged pigeon pea seeds (Figure 1A) that have been stored for less than 1 year.
Soak the seeds in distilled water for 24 h (Figure 1B). Transfer the swollen seeds to a seed tray and place them in the greenhouse.
Seeds start to germinate after 1-2 days. When the epicotyl reaches 1.5 cm, transplant the seedlings to 10 cm (diameter) x 9 cm (height) pots containing soil and sand in a volume ratio of 3:1.
NOTE:The soil consists of a mixture of nutritious soil, vermiculite, and perlite at a 2:1:1 ratio.
Grow the seedling in a greenhouse.

2. Activation of A. rhizogenes

NOTE: The strain used for A. rhizogenes transformation was the K599 preserved at -80 °C. The binary vector pROK2 (pBIN438;http://www.biovector.net/product/428388.html) contains green fluorescent protein (GFP) as an indicator gene and a kanamycin resistance gene as a selectable marker to transform A. rhizogenes.

Thaw A. rhizogenes on ice.
Dip the bacteria and line them evenly onto yeast mannitol medium (YEP) supplemented with 8 g/L of agar powder, 25 mg/L of rifampicin, and 25 mg/L of kanamycin (YRK, pH 7.0).
Incubate at 28 °C for 16 h.
Select monoclonal colonies. Culture them in a 50 mL tube containing 10 mL of YEB medium supplemented with 25 mg/L of rifampicin and 25 mg/L of kanamycin (YRK, pH 7.0). Place the centrifuge tube on a shaking incubator with a rotational radius of 10 cm, at 28 °C and 200 rpm for 16 h.

3. Plant transformation using A. rhizogenes

NOTE: Select healthy plants to infect A. rhizogenes using the following injection procedure. This procedure results in transformed hairy roots. To analyze the gene function of CcCIPK14,a control is needed. A. rhizogenes solutions with empty vector or CcCIPK14-pROK2 plasmids were injected into seedlings to induce hairy roots.

Inoculate A. rhizogenes
1. Choose pigeon pea seedlings with the same growth status.
2. Empty the air from the 1 mL syringe and aspirate 0.3 mL of bacterial liquid. Slowly push the pushrod to fill the syringe needle with bacterial liquid²¹.
3. First fix the stem of the pigeon pea seedling with tweezers, and then prick the syringe needle into the stem at 1 cm.
4. When withdrawing the syringe, completely submerge the needle tip into the stem. Slowly push the pushrod to pump the bacterial liquid out of the penetrating wound.
  NOTE: The attachment of residual bacterial liquid to the wound in bacteria droplets can improve infection and transformation efficiency.
Seedling management
NOTE: High temperature and humidity can improve the infection efficiency of A. rhizogenes.
1. Place seedlings inoculated with A. rhizogenes in a tray (30 cm x 60 cm x 6 cm) with 1 L of water. Use a transparent plastic lid (30 cm x 60 cm x 30 cm) as a cover to maintain the temperature and humidity of the internal environment.
2. Periodically remove fallen leaves and flocculent hyphae attached to leaf tips and fallen leaves.
3. After a week, the callus begins to appear in the wound. Subsequently, keep the the plastic lid half-open.
4. After 4-5 weeks, most of the callus tissue differentiated into adventitious roots. Remove the plastic lid.
5. Add 1 L of water to the tray every 3 days to keep the soil moist.
  NOTE: Pigeon pea is a drought-tolerant plant; too much water can inhibit plant growth.

4. Identification of transformed hairy roots

NOTE: Transformed hairy roots can be identified based on the morphology and gene level. This procedure primarily focuses on reporter gene (GFP) identification assay.

Collect the root tips of the hairy root and mark the remaining part.
Evaluate whether there is green fluorescence under a confocal laser scanning microscope.
Triturate 0.1 g of hairy roots with strong fluorescence signal into fine powder in liquid nitrogen.
According to the plant genomic DNA kit manufacturer's instructions, prepare the genomic DNA of pigeon pea independent transgenic lines by the modified cetyltrimethylammonium bromide (CTAB) method²³.
Use 500 ng of genomic DNA template and primers for PCR. The primers are shown in Table 1.
Perform the following amplification cycle: pre-denaturation at 94 °C for 5 min, denaturation at 94 °C for 30 s, annealing of primers at 55 °C for 30 s, and primer extension at 72 °C for 30 s. After 36 cycles and a final extension of 10 min at 72 °C, analyze the amplified products on a 1% agarose gel.
Stain the gels with nucleic acid staining and visualize them under UV light.

5. Exogenous hormone treatment

NOTE: The positive composite plants were treated with exogenous hormones to study the effect of CcCIPK14 on metabolic. The composited plants induced by A. rhizogenes were divided into three groups: JA treatment group, ABA treatment group, and control group (Figure 3A).

Reduce watering 3 days before exogenous hormone treatment.
Prepare both JA and ABA solutions at a concentration of 5 mg/L.
NOTE: The JA and ABA powder are first dissolved in ethyl alcohol, and then filled to the target volume with distilled water.
Using a spray bottle, spray JA and ABA solutions uniformly on the leaves of the plants. Treat the control group with water.
NOTE: An average of 10 mL of solution was sprayed on each seedling.
Cover with the plastic lid immediately after spraying treatment. Put it back in the artificial climate greenhouse.

6. Sample collection and preservation

NOTE: After 3 h of exogenous hormone treatment, plant materials from different treatment groups were collected.

Remove tawny and contaminated hairy roots and select those with a white appearance. Collect these hairy roots and dry them out with absorbent paper.
Divide the hairy roots collected from each seedling into two parts. Put one part into a numbered test tube and wrap it using marked tinfoil.
Lyophilize the tinfoil in liquid nitrogen, and then store all harvested tin foil at -80 °C for further investigation.

Representative Results

A. rhizogenes -mediated hairy root transformation on pigeon pea
This study described the step-by-step protocols for the genetic transformation of hairy roots mediated by A. rhizogenes, which has significance in the field of plant molecules. It took about 5 weeks to get hairy roots from the roots of pigeon pea infected by A. rhizogenes. Figure 1A showed an overview of the entire transformation process, from the injection of A. rhizogenes to obtain composite plants with hairy roots. Proliferating tissueswere observed around 1 week after infection, and its differentiation to adventitious roots was observed around 2 weeks, and a large number of hairy roots were produced at 35 days (Figure 1B). This GFP made it possible to distinguish genetically modified hairy roots from non-transgenic hairy roots through fluorescence. In Figure 2, the transformed hairy roots with GFP-pROK2 were visualized under the confocal green fluorescent protein channel. Induction of hairy roots by A. rhizogenes with the empty vector did not show green fluorescence (Figure 2A). The generated adventitious roots were identified by morphology and GFP reporter gene; the results confirmed that K599 could successfully infect and transform pigeon pea (Figure 2). The plant genomic DNA was prepared (CTAB method) for PCR analysis. The GFP was present only in hairy roots induced by A. rhizogenes carrying the GFP-pROK2 plasmid; neither the untransformed plant tissues nor the roots induced by A. rhizogenes with empty vectors were present (Figure 2B,C). These results indicated that the binary vector had been successfully transformed into the adventitious root genome¹⁶^,²¹.

To improve the transformation efficiency of A. rhizogenes,the protocol was optimized. Infection withA. rhizogenes caused abnormal growth of normal roots and leaves of the host plant and even led to death. There are several possible explanations for this result. In the early vegetative growth stage, the spontaneous propagation and transformation of host cells consumed large amounts of nutrients, which maybe the main reason for inhibiting the development of seedling and even causing plant death²⁴^,²⁵.Besides, the mechanical damage caused by inoculation may have also affected the seedlings²⁴^,²⁶^,²⁷. Meanwhile, the growth status of seedlings determines the differentiation efficiency of callus. Inoculation is best done when the seedlings are 7 days old and the stems of seedlings are incompletely lignified (Figure 1A). Under this condition, the efficiency of A. rhizogenes-mediated callus production was 76%. The findings from these studies suggest that relative humidity can affect the proliferation of callus. The proliferation and differentiation of proliferating tissues and the growth of adventitious roots both need to maintain a high relative air humidity. Many roots were created within 4 to 5 weeks of inoculation and have begun to penetrate the soil. The overall transformation efficiency of this experiment can be as high as 72%.Transformation efficiency (%) = (number of positive compound plants / number of infected plants) x 100.

Evaluation of the CcCIPK14 gene function in pigeon pea using the transgenic hairy root system
Hairy roots of CcCIPK14-OE lines were obtained using the above-mentioned hairy root induction protocol. The hairy roots could attach to the infection points on the stems to form a composite plant. As only the hairy roots are genetically modified in composite plants, they can also be used to study signal transduction between the roots and the above-ground part. The phytohormone solutions (JA and ABA) were sprayed uniformly on the leaves of composite plants, and the hairy roots were collected after 3 h (Figure 3A).The function of CcCIPK14 in transgenic roots was verified by gene expression analysis and metabolite determination. The results showed that the expression level of CcCIPK14 was up-regulated after JA and ABA treatment. Besides, the expression levels of two key enzymes for Genistein synthesis in the CcCIPK14-OE line, CcHIDH1, and CcHIDH2 were up-regulated. Compared with the control group, the Genistein content in transgenic roots increased to 0.060 mg/g FW. We compared the phenotypes before and after the transgenic plants were treated with JA/ABA, and there was little difference in morphology through comparison (Figure 3B). CcCIPK14, a key functional gene in the flavonoid metabolic pathway, can respond to hormone signals and participate in genistein biosynthesis in pigeon pea.

Figure 1: Induction of the A. rhizogenes -mediated compound plant. (A) Flow chart of the hairy roots transformation system, including activating A. rhizogenes, seedling cultivation, Agrobacterium inoculation, seedling management, and obtaining compound plants. A representative image showing the key stages. (B) The three main stages of adventitious root formation at the inoculation site: callus appears, callus proliferates, and differentiates. Scale bars are 1 cm. Please click here to view a larger version of this figure.

Figure 2: Transgenic hairy root analysis. (A) GFP signal in transgenic hairy roots, with empty vector-containing Agrobacterium solution control. Scale bars are 50 µm. (B,C) PCR amplification of genes (GFP) from genomic DNA isolated from wild-type roots and stems, leaves, and transgenic roots of compound plants. CK: Empty Vector #1-4: plasmid (binary vector pROK2 carrying GFP) as the positive control. Please click here to view a larger version of this figure.

Figure 3: CIPK14 function analysis by hairy root method and hormone treatment. (A) Process flow chart for verification and analysis of gene function through compound plants. (B) Phenotypic changes of compound plants before and after treatment with JA, ABA, and H₂O. Scale bars are 1 cm. Please click here to view a larger version of this figure.

Figure 4: Gene expression level and secondary metabolite content of hairy roots with empty vector and plasmid CcCIPK14-pROK2 (binary vector pROK2 with CcCIPK14). CcCIPK14 expression level (A), secondary metabolite content in transgenic hairy roots (B), and expression levels of CcHIDH1 and CcHIDH2 in hairy roots after hormone treatment (D). The relative expression level was normalized to that of the actin control. Data are presented as mean ± standard deviation (n = 3),* indicates a significant difference (P < 0.05) between CcCIPK14-OE and the controls (empty vector lines) using Student's t-test. (C) The biosynthesis pathway of Genistein. The enzyme catalyzing reaction HIDH, 2-hydroxyiso flavanone dehydratase, CIPK14 (Calcineurin B-like protein-interacting protein kinases). Treatments with the same letters were not significantly different based on the mean comparison by Duncan's test at p < 0.05. Please click here to view a larger version of this figure.

Primer	Sequence(5'-3')
CcCIPK14-q-F	GAGACCAACATTGATGATGTGGAAGC
CcCIPK14-q-R	CATTCATTGGTGTGTTGGCTGCTCTTC
CcHIDH1-q-F	GAGGCTGTGCTGGAGTCAAT
CcHIDH1-q-R	AGCTCAGCTAATCTGGTGGC
CcHIDH2-q-F	AGCCCCTATCTCTGTTGGGT
CcHIDH2-q-R	ACTGCTGCAAGTGGCTTACT
GFP-F	CCACAAGTTCAGCGTGTCCG
GFP-R	AAGTTCACCTTGATGCCGTTC

Table 1: Primers used in this study.

Discussion

The rapid characterization of gene function is the common goal in the study of most species, and it is particularly important for the development of resource plants. The A. rhizogenes-mediated transformation has been widely used in the hairy root culture. The hairy root culture (HRC), as a unique source of metabolite production, plays a pivotal role in metabolic engineering¹⁸^,²⁸. The application of this technology is mainly limited to the function of genes in vivo²¹. Here, we provide a basic method for studying gene function based on the previous A. rhizogenes -mediated transformation system. This method can be used to verify a variety of gene functions, such as response to environmental stress and exogenous hormones. The CcCIPK14-OE line showed that CcCIPK14 could promote the accumulation of flavonoid metabolites and respond to exogenous hormones JA and ABA. CcHIDH1 and CcHIDH2 are two essential flavonoid synthase genes, which were significantly up-regulated in the CcCIPK14-OE line. These results indicate that the method can be used as an effective tool for evaluating gene function and secondary metabolites.

An effective genetic transformation system is a prerequisite for the verification and analysis of gene function²⁹^,³⁰. A. rhizogenes is a bacterium with a natural evolutionary mechanism³¹. It contains a root-inducing (Ri) plasmid that contains root locus (rol) genes in the T-DNA region, including rolA, rolB, rolC, and rolD, which can induce hairy roots from the wound surface of the explants²⁷^,³². The A. rhizogenes -mediated transformation system has many advantages³³. First, in most species, Ri-transformed cells of the host plant can spontaneously differentiate into roots with normal phenotypes³³. When additional binary vectors are used to integrate exogenous DNA, Ri plasmids can provide the possibility of obtaining transformed hairy roots without using exogenously applied plant hormones for organogenesis³⁴. Second, Ri-transformed roots are genetically stable, because it is speculated that these transformed roots are developed from a single transformed cell¹⁷^,³³. Moreover, these hairy roots can maintain attachment to wild-type branches, resulting in composite plants¹⁶^,²⁰. Ri-transformed roots can simulate normal roots, providing experimental materials for verification and analysis of gene functions³⁵. This transformation system is suitable for plants that are difficult to regenerate, such as pigeon pea, which has low regeneration frequency³⁶^,³⁷. However, since only the hairy roots are transgenic, the function of genes on the entire plant level cannot be assessed, and transgenic traits also cannot be passed on to the offspring through sexual reproduction.

In this scheme, A. rhizogenes carrying binary vectors can induce transgenic hairy roots by an efficient and stable protocol. The basic steps of the transformation method have been outlined in the form of a flowchart (Figure 1A). After 1 week of inoculation with A. rhizogenes, calluses were observed on the wounds of the stem. After 3 weeks, the calluses differentiated to hairy roots (Figure 1B). This method is of significance because it does not require in vitro culture, hence hairy roots were obtained within 5 weeks (Figure 1). Meng et al. conducted a series of similar experiments with this method on different plants, and the results showed that most plants could obtain transgenic roots with the target gene within 2 months²¹. Pigeon pea, a protein-rich orphan, is growing in semi-arid tropics regions³⁷. The hot and humid culture environment affects the growth of pigeon pea, and can occur deciduous phenotype²¹; the phenotype can be restored by removing the plastic cover.

During these experiments, many factors must be carefully considered to rapidly obtain transformed roots. The health status of the seedlings after inoculation is the key to the success of this experiment²¹. Previous studies have shown that A. rhizogenes can induce hairy roots at the inoculation point during multiple stages of seedling growth³⁸. However, the growth status of seedings directly affects the transformation efficiency²⁶. Premature inoculation of A. rhizogenes can inhibit the growth of seedlings and even causes seedling death³⁹^,⁴⁰. To obtain maximum transformation efficiency, A. rhizogene is usually inoculated on 7-day-old seedlings. Besides, air humidity is also a major factor affecting callus proliferation. Premature removal of plastic after inoculation with A .rhizogenes can lead to browning of the callus and dieback of adventitious roots. This study used two different confirmation methods to identify positive transgenic roots: PCR amplification of the inserted gene and GFP fluorescence detection. The test results confirmed the successful conversion. The conversion efficiency is as high as 75%.

Disclosures

The authors have nothing to disclose.

Acknowledgements

The authors gratefully acknowledge the financial support by National Natural Science Foundation of China (31800509, 31922058), Outstanding Young Talent Fund in Beijing Forestry University" (2019JQ03009), the Fundamental Research Funds for the Central Universities (2021ZY16), Beijing Municipal Natural Science Foundation (6212023), and National Key R&D Program of China (2018YFD1000602,2019YFD1000605-1) and Beijing Advanced Innovation Center for Tree Breeding by Molecular Design. I wish to thank Zhengyang Hou for his guidance in writing the article and to Professor Meng Dong for his guidance on the article idea.

Materials

0.1 mL qPCR 8-strip tube (with optical caps)	KIRGEN, Shanghai, China	KJ2541
ABA	Solarbio Life Science, Beijing, China	A8060
Agar powder	Solarbio Life Science, Beijing, China	A8190
Centrifuge	Osterode am Harz, Germany	d37520
CFX Connect TW Optics Module	Bio-rad, US	1855200
constant temperature incubator	Shanghai Boxun Industry & Commerce Co., Ltd, Shanghai,China	BPX-82
Diposable Petri dish	Corning, US
Dry Bath	Gingko Bioscience Company/Coyote bioscience, China	H2H3-100C
Eastep Total RNA Extraction Kit50	Promega, Beijing, China	LS1030
Electronic balance	Tianjin, China	TD50020
Filter pape	Hangzhou wohua Filter Paper Co., Ltd, China
FiveEasy Plus	Mettler Toledo, Shanghai, China	30254105
Flowerpot 9*9	China
JA	Solarbio Life Science, Beijing, China	J8070
Kan	Solarbio Life Science, Beijing, China	K8020
MagicSYBR Mixture	CWBIO, Beijing, China	CW3008M
Mini Microcentrifuge	Scilogex, Beijing, China	S1010E
NaCl	Solarbio Life Science, Beijing, China	S8210
NanPhotometer N50 Touch	IMPLEN GMBH, Germany	T51082
Purelab untra
Rifampicin	Solarbio Life Science, Beijing, China	R8010
Seedling box 30*200	China
Thermal Cycler PCR	Bio-rad, US	T100
Thermostatic oscillator	Beijing donglian Har lnstrument Manufacture Co.,Ltd,China	DLHE-Q200
Tomy Autoclave	Tomy, Japan	SX-500
Tryptone	Solarbio Life Science, Beijing, China	LP0042
UEIris II RT-PCR System for First-Strand cDNA Synthesis( with dsDNase)	US Everbright INC, Jiangsu, China	R2028
Yeast Extract powder	Solarbio Life Science, Beijing, China	LP0021

References

Poland, J. A., Rife, T. W. Genotyping-by-sequencing for plant breeding and genetics. The Plant Genome. 5 (3), (2012).
Barabaschi, D., et al. Next generation breeding. Plant Science. 242, 3-13 (2016).
Petri, C., Webb, K., Hily, J. -. M., Dardick, C., Scorza, R. High transformation efficiency in plum (Prunus domestica L.): a new tool for functional genomics studies in Prunus spp. Molecular Breeding. 22 (4), 581-591 (2008).
Tang, H., Ren, Z., Reustle, G., Krczal, G. Plant regeneration from leaves of sweet and sour cherry cultivars. Scientia Horticulturae. 93 (3-4), 235-244 (2002).
Yang, L., et al. Response of plant secondary metabolites to environmental factors. Molecules. 23 (4), 762 (2018).
Ross, J. J., Weston, D. E., Davidson, S. E., Reid, J. B. Plant hormone interactions: how complex are they. Physiologia Plantarum. 141 (4), 299-309 (2011).
Meng, D., et al. The pigeon pea CcCIPK14-CcCBL1 pair positively modulates drought tolerance by enhancing flavonoid biosynthesis. The Plant Journal. , (2021).
Wen, W., Alseekh, S., Fernie, A. R. Conservation and diversification of flavonoid metabolism in the plant kingdom. Current Opinion in Plant Biology. 55, 100-108 (2020).
Shah, A., Smith, D. L. Flavonoids in agriculture: Chemistry and roles in, biotic and abiotic stress responses, and microbial associations. Agronomy. 10 (8), 1209 (2020).
Zhang, W., Jiang, W. UV treatment improved the quality of postharvest fruits and vegetables by inducing resistance. Trends in Food Science & Technology. 92, 71-80 (2019).
Koyama, R., et al. Exogenous abscisic acid promotes anthocyanin biosynthesis and increased expression of flavonoid synthesis genes in Vitis vinifera× Vitis labrusca table grapes in a subtropical region. Frontiers in Plant Science. 9, 323 (2018).
Guo, M., Ye, J., Gao, D., Xu, N., Yang, J. Agrobacterium-mediated horizontal gene transfer: Mechanism, biotechnological application, potential risk and forestalling strategy. Biotechnology Advances. 37 (1), 259-270 (2019).
Veena, V., Taylor, C. G. Agrobacterium rhizogenes: recent developments and promising applications. In Vitro Cellular & Developmental Biology-Plant. 43 (5), 383-403 (2007).
Lacroix, B., Citovsky, V. Pathways of DNA transfer to plants from Agrobacterium tumefaciens and related bacterial species. Annual Review of Phytopathology. 57, 231-251 (2019).
Guan, Y., Li, S. -. G., Fan, X. -. F., Su, Z. -. H. Application of somatic embryogenesis in woody plants. Frontiers in Plant Science. 7, 938 (2016).
Alpizar, E., et al. Efficient production of Agrobacterium rhizogenes-transformed roots and composite plants for studying gene expression in coffee roots. Plant Cell Reports. 25 (9), 959-967 (2006).
Hwang, H. -. H., Yu, M., Lai, E. -. M. Agrobacterium-mediated plant transformation: biology and applications. The Arabidopsis Book. 15, (2017).
Srivastava, S., Srivastava, A. K. Hairy root culture for mass-production of high-value secondary metabolites. Critical Reviews in Biotechnology. 27 (1), 29-43 (2007).
Porter, J. R., Flores, H. Host range and implications of plant infection by Agrobacterium rhizogenes. Critical Reviews in Plant Sciences. 10 (4), 387-421 (1991).
Fan, Y. -. l., et al. One-step generation of composite soybean plants with transgenic roots by Agrobacterium rhizogenes-mediated transformation. BMC Plant Biology. 20, 1-11 (2020).
Meng, D., et al. Development of an efficient root transgenic system for pigeon pea and its application to other important economically plants. Plant Biotechnology Journal. 17 (9), 1804-1813 (2019).
Ma, R., et al. Agrobacterium-Mediated genetic transformation of the medicinal plant Veratrum dahuricum. Plants. 9 (2), 191 (2020).
Mi, Y., et al. Inducing hairy roots by Agrobacterium rhizogenes-mediated transformation in tartary buckwheat (Fagopyrum tataricum). Journal of Visualized Experoments: JoVE. (157), (2020).
Cordovez, V., et al. Plant phenotypic and transcriptional changes induced by volatiles from the fungal root pathogen Rhizoctonia solani. Frontiers in Plant Science. 8, 1262 (2017).
Trovato, M., Mattioli, R., Costantino, P. From A. rhizogenes RolD to plant P5CS: exploiting proline to control plant development. Plants. 7 (4), 108 (2018).
Van Altvorst, A. C., et al. Effects of the introduction of Agrobacterium rhizogenes rol genes on tomato plant and flower development. Plant Science. 83 (1), 77-85 (1992).
Bahramnejad, B., Naji, M., Bose, R., Jha, S. A critical review on use of Agrobacterium rhizogenes and their associated binary vectors for plant transformation. Biotechnology Advances. 37 (7), 107405 (2019).
Gutierrez-Valdes, N., et al. Hairy root cultures-a versatile tool with multiple applications. Frontiers in Plant Science. 11, (2020).
Che, P., et al. Developing a flexible, high-efficiency Agrobacterium-mediated sorghum transformation system with broad application. Plant Biotechnology Journal. 16 (7), 1388-1395 (2018).
Keshavareddy, G., Kumar, A., Ramu, V. S. Methods of plant transformation-a review. International Journal of Current Microbiology and Applied Sciences. 7 (7), 2656-2668 (2018).
Lacroix, B., Citovsky, V. Beyond Agrobacterium-mediated transformation: horizontal gene transfer from bacteria to eukaryotes. Agrobacterium Biology. , 443-462 (2018).
Sarkar, S., Ghosh, I., Roychowdhury, D., Jha, S. . Biotechnological approaches for medicinal and aromatic plants. , 27-51 (2018).
Singh, R. S., et al. . Biotechnological Approaches for Medicinal and Aromatic Plants. , 235-250 (2018).
Bahramnejad, B., Naji, M., Bose, R., Jha, S. A critical review on use of Agrobacterium rhizogenes and their associated binary vectors for plant transformation. Biotechnology Advances. 37 (7), 107405 (2019).
Meng, D., et al. Development of an efficient root transgenic system for pigeon pea and its application to other important economically plants. Plant Biotechnology Journal. 17 (9), 1804-1813 (2019).
Surekha, C., et al. Agrobacterium-mediated genetic transformation of pigeon pea (Cajanus cajan (L.) Millsp.) using embryonal segments and development of transgenic plants for resistance against Spodoptera. Plant Science. 169 (6), 1074-1080 (2005).
Saxena, K. Genetic improvement of pigeon pea-a review. Tropical Plant Biology. 1 (2), 159-178 (2008).
Hada, A., et al. Improved Agrobacterium tumefaciens-mediated transformation of soybean [Glycine max (L.) Merr.] following optimization of culture conditions and mechanical techniques. In Vitro Cellular & Developmental Biology-Plant. 54 (6), 672-688 (2018).
Foti, C., Pavli, O. High-efficiency Agrobacterium rhizogenes-mediated transgenic hairy root induction of lens culinaris. Agronomy. 10 (8), 1170 (2020).
Bhattacharya, A., Sood, P., Citovsky, V. The roles of plant phenolics in defence and communication during Agrobacterium and Rhizobium infection. Molecular Plant Pathology. 11 (5), 705-719 (2010).

Automatically Generated