Quantitation of Rabies Virus in Various Bovine Brain Structures

This study was approved by and conducted in strict accordance with the recommendations for the use of animals provided by the Institutional Animal Care and Use Committee (IACUC) of the Centro Nacional de Investigación Disciplinaria en Microbiología Animal (CENID-MA).

1. Samples

1. Use different areas of the brain dissected from 6 different rabies-positive bovine brains for RT-PCR analysis.

2. Direct fluorescent antibodies (DFAs) to confirm rabies

NOTE: Detection of the rabies antigen by DFA is a qualitative method to determine the presence of the rabies nucleoprotein using fluorescein-labeled antibodies. The test was performed using the protocol provided by Dean et al. (1966)²⁰, as described below.

1. Make two impressions from each tissue dissected from different brain structures on a sterile slide of approximately 15 mm diameter. Use a wooden applicator to smear an approximately 3 mm³ portion of the tissue onto the sterile slide. To create the smear, gently press the wooden applicator against the slide manually.
2. Fix the sample smear slides by submersing the slides in 100% acetone for 1 h at -20 °C. After incubation, dry the slides on a dry cloth at 21 °C for 30 min.
3. Add 50 µL of the fluorescein-labeled anti-nucleoprotein antibody to each brain smear at a 1:10 dilution by dispensing through a syringe.
4. Incubate the slides with the conjugate in a humid chamber at 37 °C for 1 h.
5. After incubation, wash the slides twice with water and with PBS to eliminate excess conjugate. Allow the slides to dry at 21 °C. Carefully blot to remove excess liquid and then briefly air-dry prior to mounting.
6. Add a drop of 50% phosphate glycerin to cover the surface of the section, and then cover with a coverslip. Observe the sections under an epifluorescence microscope at 40x magnification.
   1. Process and observe the positive and negative controls (positive control: mouse brains inoculated with RABV; negative controls: RABV-negative bovine brains) in the same manner as the samples.

3. Generating positive control for RT-PCR

1. Obtain BHK-21 cells from the germplasm bank. Use cells up to the 70^th passage to replicate the RABV Evelyn-Rokitnicki-Abelseth (ERA) strain using passage 2.
2. Maintain and propagate BHK-21 cells in bottles containing minimum essential medium (MEM) supplemented with 10% fetal calf serum (FCS) at 37 °C in the presence of CO₂ (5%) and under humid conditions. Grow the cells in 25 cm² culture flasks until they reach 80% confluence and then subculture.
3. Remove the culture medium from the cells and wash the bottle with phosphate buffered saline (PBS). Inoculate the culture with 10⁵ TCID/mL of RABV strain ERA. Incubate the viral inoculum for 2 h under constant shaking at 37 °C in the presence of CO₂ (5%) and under humid conditions.
4. Remove the infection medium and add MEM supplemented with 5% (serum fetal bovine) SFB. Incubate for 72 h at 37 °C in the presence of CO₂ (5%) in humid conditions.
5. Harvest RABV 3 days after inoculation when the cells exhibit cytopathic effects. Freeze the infected cells and then thaw them at 4 °C to lyse the cells. Collect the medium from the bottle, and then place the cells into a centrifuge tube for centrifugation at 1,050 x g for 10 min at 4 °C.
6. Store the supernatants from RABV at -80 °C, and prepare working aliquots for storage at -70 °C.
7. Intracerebrally inoculate the virus obtained in the previous step into 21 day old female CD1 mice. Use a 1 mL syringe to inoculate 50 μL of solutions containing 10⁶ MICLD₅₀ (mouse infectious culture lethal dose 50%) doses into mice²².

4. RNA extraction

NOTE: Total RNA was extracted directly from bovine brains using an organic extraction method according to following protocol.

1. Use 100 mg of brain tissue from each anatomical structure to extract total RNA using a commercially available reagent containing guanidium isothiocyanate.
2. Manually homogenize a total of 100 mg of tissue from each structure in 1 mL of the guanidium isothiocyanate reagent by vortexing using a Dounce homogenizer with a small pestle inside the microtube for 15 s at maximum speed.
3. Incubate the samples on ice for 5 min, and then add 200 μL of chloroform. Mix the samples vigorously for 15 s, incubate on ice for 2 to 3 min, and then centrifuge at 12,000 x g for 15 min at 4 °C.
4. Transfer the aqueous phase to a clean tube and add 500 μL of isopropyl alcohol. Incubate the samples for 15 min at 21 °C.
5. Centrifuge the samples at 12,000 x g for 10 min at 4 °C. Aspirate the aqueous supernatant by pipetting. The isolated RNA will be present as a pellet in the tube.
6. Next, wash the RNA pellet with 1 mL of 75% ethanol by pipetting, and centrifuge at 7500 x g for 5 min at 4 °C.
7. Decant the supernatant and air-dry the RNA pellet at room temperature (21 °C). Next, dilute the pellet in 50 μL of nuclease-free water.
8. Determine the RNA concentration and quality at 260 nm using a spectrophotometer. Store RNA at -80 °C until use.
9. Remove DNA from RNA samples by digestion with DNase I. Add 2 U of DNase I per 1 µg of RNA extracted in the previous step. Next, add 5 µL of 10x reaction buffer and then incubate at 37 °C for 30 min. Inactivate the DNase I by adding 1 μL of EDTA to the mixture followed by incubation for 10 min at 65 °C.

5. cDNA synthesis and PCR

1. Synthesize first-strand cDNA using oligo dT and reverse transcriptase. For every 1 μg of RNA, add 1 μL of oligo DT (500 μg/mL), 1 μL of 10 mM dNTP mix, and nuclease-free distilled water to a final volume of 12 μL. Incubate the mixture at 65 °C for 5 min.
2. Chill the reaction mixture to 4 °C. Centrifuge the tube for 30 s at 1,050 x g, and then add 4 μL of reaction buffer, 2 μL 0.1 M DTT, and 1 μL of ribonuclease inhibitor (40 U/μL).
3. Incubate the reaction mixture at 37 °C for 2 min, and then add 1 µL of reverse transcriptase (200 U). Next, incubate the reaction mixture for 50 min at 37 °C, and then inactivate the reaction at 70 °C for 15 min.
4. Store the cDNA at -20 °C prior to use.
   NOTE: To verify the quality of the synthesized cDNA, perform the amplification of a 761 bp fragment of the RABV N gene prior to performing the synthesis in vitro. Use the protocol described by Loza-Rubio et al.¹¹ as described in step 5.5 below.
5. Perform PCR using Taq DNA polymerase under the following conditions. Perform the reaction set up as follows: 10x Taq buffer containing 20 mM MgCl₂, 0.2 mM dNTPs, 1 U Taq polymerase, 10 μM of each primer (SuEli+: 5′ cgtrgaycaatatgagtaca 3′ and SuEli-: 5′ caggctcraacattcttctta 3′), 2.5 μL of cDNA, and ultrapure water to a final volume of 50 µL.
6. Perform the amplification in a thermocycler using the following cycling conditions: 95 ° C for 3 min; 35 cycles of 95 ° C for 30 s, 60 °C for 30 s, and 72 °C for 1 min; one cycle of 72 °C for 7 min.
7. Assess the presence of the 761 bp PCR products using a 1% agarose gel.

6. In vitro transcription

NOTE: In vitro transcription generates mRNA of a target gene. Use a primer pair that amplifies the complete RABV N gene and one that is used as a positive control for the qRT-PCR assay. These primers are designed to amplify the complete RABV N gene and to add a promoter that recognizes the T7 polymerase (TAATACGACTCACTATAG).

1. To amplify the whole N gene RABV, use the primers Trans-Nrab forward (5ʹ gatgagtcactcgaatatgtctt 3ʹ) and reverse (5ʹ caataatacgactcactatagggatggatgccgacaagatt 3ʹ) and a high-fidelity PCR kit.
   1. For each reaction, prepare a PCR master mix by adding to a clean PCR tube reaction buffer 10x, 2 mM DMSO, 25 mM MgCl₂, 10 mM dNTPs, 10 μM of each primer, 0.5 U of high-fidelity polymerase, 1.5 μL of cDNA (prepared in step 5), and ultrapure water to a final volume of 50 µL.
   2. Use a thermocycler set to the following conditions for amplification: 94 °C for 1 min; 4 cycles of 94 °C for 1 min, 40 °C for 1 min, and 72 °C for 2 min; 35 cycles of 94 °C for 1 min, 60 °C for 1 min, and 72 °C for 2 min; final extension of 72 °C for 2 min.
2. To use the PCR product as a template for the in vitro synthesis and to remove components of the enzymatic reaction from step 6.1.2, purify the PCR product using a column-based concentrator kit according to the manufacturer's instructions, and then quantify using a spectrophotometer.
3. For RNA synthesis, use an in vitro transcription kit with the following reaction mixture: 5 μL T7 Transcription 5x buffer, 1.9 μL of each triphosphate nucleotide, 10 μg of purified RABV N DNA VP2 DNA, and 2.5 μL of the enzyme mixture. Next, incubate the mixture at 37 °C for 4 h. Then, add 1 μL of 1 U/μg RNase-Free DNase to the reaction mixture and incubate for 15 min at 37 °C to eliminate DNA contamination.
4. Purify the in vitro transcribed RNA and then concentrate it using phenol:chloroform:isoamyl alcohol (25:24:1).
5. Resuspend the purified RNA pellet into 70 μL of TE buffer, and then store at -80 °C until use.
6. Repeat the PCR protocol from step 6.1 until approximately 5 μg of PCR product is obtained. After purification and concentration, the in vitro transcribed N gene mRNA will be present at a concentration of 4.711 μg/μL.
7. Confirm that the in vitro transcribed mRNA corresponds to the N gene following step 5 of this protocol and use this as a positive control for the real-time reverse transcription polymerase chain reaction (qRT-PCR).

7. Real-time reverse transcription polymerase chain reaction (qRT-PCR)

1. For qRT-PCR, use an in vitro mRNA transcript encoding the complete N gene as a positive control along with a commercial one-step qRT-PCR kit using hybridization probes according to the manufacturer's instructions. Use the probe and primers described by Carneiro et al. (2010)²³ to detect a conserved region of the RABV gene N (BRDesrot-Rev: 5′ aaactcaagagaaggccaacca 3′, BRDesrot-Fwd: 5′ cgtactgatgtggaagggaattg 3′, and BRDesrot-Probe: 5′-FAM-acaagggaccctactgtttcagagcatgc-3′-BHQ).
2. Use the following thermal cycling conditions: 1 cycle of 50 °C for 10 min and 95 °C for 2 min; 40 cycles of 95 °C for 15 s and 50 °C for 30 s.

8. Calibration curve or standard curve

1. Perform serial dilutions of the in vitro transcribed mRNA by serially pipetting 1 μg/μL of mRNA into tubes until six decuple dilutions are obtained. Prepare tubes at a 100 μL volume in triplicate for use in creating the standard curve. Perform qRT-PCR as described in step 7.
2. Perform qRT-PCR in a thermocycler with a rotor by processing the various brain samples simultaneously with the running reactions for creating the standard curve and using positive controls, negative controls, and supernatants isolated from cell culture.
3. To evaluate the limit of detection, test efficacy, and sensitivity of the test, use a standard curve in triplicate under the same conditions.

9. qRT-PCR of biological samples

1. For the detection of RABV gene N, use the RNA from field samples, positive controls, negative controls, and cell culture supernatants to perform qRT-PCR using the PCR kit described in step 7.
2. To determine the number of copies of the RABV genome present in the bovine brain samples, obtain Ct data from the standard curve and biological samples and from those interpolated from the calibration curve equation.